Cfa-miRNAs-122 and -21 as modern biomarkers of primary hepatitis in dogs

Cover Page

Abstract


Primary hepatitis (PH) is one of the most frequently diagnosed hepatic diseases in dogs. Its popular forms are acute hepatitis (AH) and chronic active hepatitis (CAH) which can progress to hepatic fibrosis and cirrhosis. This investigation aimed to evaluate the use of hepatocyte released Canine familiaris miRNAs(cfamiR)-122 and -21 as serum biological markers for the early and reliable diagnosis of PH and to reveal the onset of hepatic fibrosis. After the ultrasonographic and histological examination, fifteen healthy dogs were involved in the study as control group to compare with other thirty dogs confirmed to have AH or CAH (n = 15). Activity of liver enzymes as well as serum level of globulin and total bilirubin were significantly elevated in AH (P < 0.001) and CAH (P < 0.01) groups whereas, serum level of total protein, albumin, BUN and A/G ratio were significantly lowered in both PH groups (P < 0.01) compared to control. Cfa-miR-122 significantly expressed in AH (P < 0.001) and CAH (P < 0.01) and exhibited a potential significance in distinguishing these groups from control with an area under the curve (AUC) of 0.98 and 0.96, respectively. Additionally, cfa-miR-122 displayed a potential role in distinguishing AH (P < 0.05) from CAH group with an AUC of 0.85. Cfa-miR-21 was only expressed in dogs of CAH group and displayed a potential role in distinguishing this group (P < 0.001) from AH and healthy groups with an AUC of 0.99 and 0.88, respectively. Therefore, cfa-miR-122 can be significantly expressed in dogs with two forms of PH whereas, cfa-miR-21 could be potentially enhanced only in chronic form of PH and may act as new non-invasive biomarker for distinguishing AH from CAH.


Full Text

Введение Первичный гепатит (ПГ) - одно из наиболее часто диагностируемых паренхиматозных заболеваний печени у собак, и к его наиболее часто определяемым формам относятся острый идиопатический и хронический гепатоцеллюлярный апоптоз или некроз с высокой распространенностью хронической формы, для которой фиброз печени является определяющим [1, 2]. Часто первичные гепатопатии являются причиной заболеваемости и летальности среди различных пород собак, включая лабрадор ретривера, английского кокер спаниеля, доберман пинчера, шотландского терьера и бедлингтон терьера [3]. Клинические признаки обычно не информативны в большинстве случаев с первичным гепатитом, за исключением фиброза или цирроза печени на конечной стадии. Неинвазивные стандартные биомаркеры печени объективны для диагностики и мониторинга печеночных некровоспалительных изменений при остром и хроническом гепатите, однако при ней невозможно выявить раннее отложение компонентов фибриллярного внеклеточного матрикса (коллагены типа I и типа III) и прогрессирующее рубцевание печени в связи с гепатоцеллюлярным повреждением или воспалением [4, 5]. С другой стороны, ультразвуковое исследование (УЗИ) брюшной полости не является точным инструментом для распознавания или дифференциации различных легких форм первичного гепатита и эффективно только на поздних стадиях заболевания [6], следовательно, гистологическое исследование печени в настоящее время является единственным средством диагностики степени поражения печени, но, несмотря на это, не может использоваться регулярно, поскольку является инвазивным и дорогостоящим [7]. Таким образом, выявление неинвазивных сывороточных биомаркеров, которые могут точно диагностировать степень воспалительной активности печени и фиброза на ранней стадии, необходимо в ранней дифференции острого и хронического активного гепатита. Зрелые микроРНК (miR, класс эндогенных некодирующих РНК длиной приблизительно 19…25 нуклеотидов) выступают в качестве центрального регулятора молекулярных механизмов, участвующих в различных патологиях печени. В настоящее время их применяют в качестве диагностического критерия при различных заболеваниях [8]. В этом контексте, cfa-miR-122 считают одной из самых распространенных микроРНК в гепатоцитах (почти 70 % от общей экспрессии печеночной микроРНК), что делает его потенциально идеальным биомаркером при различных повреждениях печени [9, 10]. Также установлено, что cfa-miR-21 имеет значение в регуляции экспрессии посттранскрипционных генов, связанных с патофизиологией повреждения печени, активацией непаренхимных клеток, включая печеночные звездчатые клетки (HSC), клетки-предшественники печени и макрофаги, приводя к фиброзу [10, 11]. Целью исследования - оценка возможного использования cfa-miR-122 и 21, полученных из гепатоцитов, в качестве неинвазивного стабильного биомаркера для ранней диагностики ПГ и отражения степени фиброза печени, связанного с ХАГ у собак. Материалы и методы исследования Животные и дизайн исследования. Настоящее исследование проводилось на кафедре диагностики болезней, терапии, акушерства и репродукции животных и в Инновационном ветеринарном центре Московской государственной академии ветеринарной медицины и биотехнологии (ИВЦ МВА). Гематологические исследования проведены в лаборатории ветеринарной клиники «КОВЧЕГ»; гистологические исследования - в ветеринарном центре патоморфологии и лабораторной диагностики доктора Н.В. Митрохиной; исследования микроРНК - в лаборатории молекулярной генетики и медицинской геномики ФГАУ «НМИЦ Здоровья детей». Все исследования проводили в период с сентября 2018 г. по октябрь 2019 г. У тридцати животных с клиническими признаками первичного гепатита, а также повышенным уровнем ферментов печени, аномальной печеночной эхогенностью, установленной при ультразвуковом исследовании (Mindray DC-8 Expert®, преобразователь 6,5…8 МГц, Китай) гистологически подтверждалась некровоспалительная активность печени или фиброз. На основании гистологических данных выделенные животные были разделены на две равные группы. В первую группу входили собаки с острым гепатитом (ОГ), а во вторую с хроническим активным гепатитом (ХАГ). Для сравнения пятнадцать здоровых животных с показателями крови, не выходящими за референсные значения, и вместе с тем, по данным ультразвукового исследования, не измененной структурой органа, служили контролем. Сбор и обработка образцов. Взятия крови проводили из яремной вены от каждого животного в обычную пробирку (Vacuette® Greiner Bio-One, Германия), после чего образцы оставляли в холодильнике на 15 мин для максимального отведения сгустка. Сыворотку получали центрифугированием при 3000 об / мин в течение 10 мин при 20 °C на центрифуге CM-6M Sky Line (ELMI®, Латвия). Отделенная сыворотка распределялась на два образца, первый из которых использовали для биохимического анализа, а второй консервировали при -80 °С до анализа на микроРНК. Биопсию печени проводили у каждого животного под контролем УЗИ с использованием полуавтоматической иглы (spring cut®, Sterylab, Италия). Полученный материал фиксировали в 10 % забуференном формалине для гистологического исследования. Анализ биохимических показателей сыворотки. Сывороточную активность аланинаминотрансферазы (АЛТ), аспартатаминотрансферазы (АСТ), щелочной фосфатазы (ЩФ) и гамм-глутамилтрансферазы (ГГТ), а также амилазу и липазу в дополнение к уровню общего белка (О. Белок), альбумин, глобулин, отношение альбумин/глобулин (А/Г), общий билирубин (О. Билирубин), мочевину, креатинин и глюкозу исследовали с помощью наборов Catalyst NSAID6 Clip® и Chem 17Clip® (IDEXX Laboratories®, США) на биохимическом анализаторе (Catalyst One®; IDEXX Laboratories, США). Гистологические исследования. Полученные при биопсии образцы заливали в парафин (Paraplast plus®, США). Срезы толщиной 4 мкм окрашивали гематоксилином и эозином (Ги Э, кат. № RRSK26; Atom Scientific®, Великобритания) [9, 11]. Волокна соединительной ткани (коллаген I и III типа) определяли по Picrosirius red (кат. № KT037; Diagnostic Bio Systems®, Нидерланды). Гистологическая оценка проводилась в соответствии со стандартами WSAVA с помощью микроскопа Микмед-5® («ЛОМО», Россия). Выделение РНК. Общая РНК, включая микроРНК, была выделена из каждого образца с использованием реагента для лизиса (QIAzol®) в составе набора для сыворотки / плазмы miRNeasy (кат. № 217184 Qiagen®, Германия) в соответствии с предписаниями производителя. Кроме того, во время стадии выделения 3,5 мкл синтетического Caenorhabditis elegans miR-39 (cel-miR-39, кат. № 219610, Qiagen®, Германия) добавляли при 1,6 × 108 копий/мкл рабочего раствора в качестве контроля выброса для каждого денатурированного образца сыворотки с целью оценки эффективности выделения РНК [10]. Концентрацию и чистоту выделенных образцов РНК определяли с помощью Nano photometer® (NP80, Германия) при оптической плотности 260 и 280 нм; образцы, отношение поглощения РНК (A260: A280) в которых было равно 1,6 и более, исследовали далее [13]. Обратная транскрипция и количественная оценка микроРНК с помощью полимеразной цепной реакции в реальном времени (ОТ-ПЦР). Выделенные образцы РНК подвергали обратной транскрипции с использованием набора miScript II RT (кат. № 218160, Qiagen®, Германия) для получения комплементарной ДНК в соответствии с инструкциями производителя. После этого для определения относительной экспрессии выбранных эндогенных микроРНК и экзогенного cel-miR-39 была проведена ОТ-ПЦР в системе обнаружения ПЦР в реальном времени CFX-96® (Bio-Rad, США) с использованием набора miScript SYBR Green для ПЦР (Кат. № 218073 Qiagen®, Германия) в соответствии с miScript-PCR-System справочником. Условия реакции амплификации ПЦР были следующими: 1 цикл-начальной денатурации при 95 °C в течение 15 мин и 45 циклов 3-этапной ПЦР, включая: 15 с денатурации при 94 °C, отжиг при 55 °C в течение 30 с и затем удлинение в течение 30 с при 70 °C. Все исследования проводили в трех последовательностях для каждого образца, и средний пороговый цикл Ct был оценен и использован в последующем. Полученные из ПЦР значения Ct каждой эндогенной cfa-микроРНК были нормализованы против cfa-miR-16 в качестве эндогенного эталонного гена (из-за их относительно стабильной экспрессии) и cel-miR-39 в качестве экзогенного синтетического эталонного гена (добавлено во время выделения РНК), ΔCt = Ct микроРНК - 0,5 × (Ct cel-miR-39 + Ct miR-16) [10]. Все данные были относительно выражены как кратное изменение по сравнению с контролем с использованием сравнительного метода Ct (2-ΔΔCt метод) [14]. Специфические прямые праймеры к интересующим cfa-микроРНК, а также эндогенному эталонному гену были разработаны и синтезированы компанией «Евроген» (Москва, Россия). Как показано в табл. 1, специфический прямой праймер cel-miR-39 и универсальный обратный праймер были включены в наборы (Qiagen®). Оба эталонных гена не были включены в статистический анализ, а использовались только для нормализации данных. Таблица 1 Зрелые последовательности и специфические прямые праймеры сыворотки микроРНК Имя гена Номер доступа Зрелая последовательность 5’-3’ Последовательность праймеров 5’-3’ cfa-miR-122-5p MIMAT0006619 UGGAGUGUGACAAUGGUGUUUG CAAACACCATTGTCACACTCCA cfa-miR-21-5p MIMAT0006741 UAGCUUAUCAGACUGAUGUUGA TCAACATCAGTCTGATAAGCTA cfa-miR-16-5p MIMAT0006648 UAGCAGCACGUAAAUAUUGGCG CGCCAATATTTACGTGCTGCTA Table 1 Mature sequences and specific forward primers for serum cfa-miRNA Gene Access number Mature sequence 5’- 3’ Primer sequence 5’- 3’ cfa-miR-122-5p MIMAT0006619 UGGAGUGUGACAAUGGUGUUUG CAAACACCATTGTCACACTCCA cfa-miR-21-5p MIMAT0006741 UAGCUUAUCAGACUGAUGUUGA TCAACATCAGTCTGATAAGCTA cfa-miR-16-5p MIMAT0006648 UAGCAGCACGUAAAUAUUGGCG CGCCAATATTTACGTGCTGCTA Статистический анализ. Данные были статистически проанализированы с использованием SPSS версии 20.0 (IBM Corp., США). Расчетные непрерывные переменные включали: возраст, массу тела, биохимические показатели, экспрессию cfa-микроРНК в сыворотке, категориальные переменные включали в себя породу и пол. Тест Шапиро-Вилка подтверждал распределение нормальности всех непрерывных переменных (Р > 0,05), за исключением экспрессии cfa-микроРНК (Р < 0,05). Среднее ± стандартное отклонения (SD) были получены для объяснения нормально распределенных переменных, в то время как значимые различия между исследуемыми группами оценивались путем выполнения одностороннего ANOVA с поправкой Бонферрони. Медиана и размах использовались для выявления уровней экспрессии cfa-микроРНК, а значимость различий между группами оценивалась с помощью теста Крускала - Уоллиса с поправкой Бонферрони. После этого диагностическое значение cfa-микроРНК для различия между группами первичного гепатита и контрольной группой было выявлено путем расчета площади под кривой ошибок (AUC-ROC) и предельного значения для оценки оптимального процента чувствительности и специфичности. Для всех показателей значимость была установлена на уровне Р < 0,05 [10, 15]. Результаты Исследование животных обеих опытных групп с признаками первичного гепатита показало, что чаще заболевание наблюдается у самок собак лабрадор-ретривера и русского той-терьера, при этом заболевание характеризуется неспецифическими клиническими признаками (прерывистая рвота, депрессия и анорексия) при значительно более высоком среднем возрасте (P < 0,001) и низкой средней массе тела (P < 0,05) по сравнению с контрольной группой (табл. 2). Таблица 2 Показатели массы тела и возраста у животных у контрольной и опытных групп Переменные Группы Контроль n = 15 ОГ n = 15 ХАГ n = 15 Порода (№ ) Русский той-терьер (5) (5) (4) Лабрадор ретривер (6) (9) (10) Йоркширский терьер (1) (1) (0) Доберман пинчеры (3) (0) (1) Пол (№ ) Самка (8), Самец (7) Самка (11), Самец (4) Самка (13), Самец (2) Возраст, лет, Среднее ± SD 5,35±1,41 8,65±1,18*** 9,30±1,03*** Масса тела, кг, Среднее ± SD 6,20±1,55 5,88±1,43* 5,76±1,29* *P < 0,05, ***P < 0,001 между группами Table 2 Body weight and age of animals from the control and experimental groups Parameter Groups Control n = 15 AH n = 15 CAH n = 15 Breed (No) Russian Toy Terrier (5) (5) (4) Labrador retriever (6) (9) (10) Yorkshire Terrier (1) (1) (0) Doberman Pinscher (3) (0) (1) Sex (No) Female (8), Male (7) Female (11), Male (4) Female (13), Male (2) Age, years, Mean ± SD 5.35±1.41 8.65±1.18*** 9.30±1.03*** Weight, kg, Mean ± SD 6.20±1.55 5.88±1.43* 5.76±1.29* *P < 0.05, ***P < 0.001 significance difference between groups Биохимические результаты. Анализ табл. 3 показал, что сывороточная активность ферментов печени (AЛT, ACT, ЩФ и ГГT), а также концентрация глобулина и О. Билирубина были значительно повышены у собак с ОГ (P < 0,001) и ХАГ (P < 0,01) по сравнению с контрольной группой. показатели общего белка, альбумина, мочевины отношение А/Г были достоверно снижены у животных групп ОГ или ХАГ (P < 0,01) по сравнению с контролем, тогда как концентрация глюкозы, креатинина, липазы и амилазы не имела различий во всех наблюдаемых группах, что может указывать на отсутствие патологии поджелудочной железы и почек. Таблица 3 Биохимические показатели сыворотки животных контрольной и опытных групп Переменные Группы Контроль ОГ ХАГ AЛT, ед/л 45,43 ± 6,24 121,23 ± 21,37*** 91,75 ± 11,32** ACT, ед/л 38,74 ± 3,41 75,69 ± 5,97*** 61,47± 4,21** ЩФ, ед/л 69,90 ± 4,15 108,90 ± 13,28*** 94,54 ±9,37** ГГT, ед/л 6,73 ± 0,51 9,67 ± 0,78*** 8,45 ± 0,76** О. Белок, г/дл 6,05 ± 0,61 4,98 ± 0,33** 4,85 ± 0,42** Альбумин, г/дл 3,38 ± 0,27 1,89 ± 0,22** 1,87 ± 0,25** Глобулина, мкмоль/л 2,66 ± 0,53 3,10 ±0,31*** 2,98 ± 0,43** А / Г 1,32± 0,29 0,63± 0,11** 0,61± 0,13** О. Билирубин, мкмоль/л 4,07± 0,42 5,53± 0,32*** 5,04± 0,48** Мочевина, мкмоль/л 5,71 ± 0,52 4,72 ± 0,57** 4,48 ± 0,44** Глюкоза, мг/дл 4,10 ± 0,53 4,16 ± 0,39 4,13 ± 0,23 Креатинин, мкмоль/л 38,92 ± 2,91 40,11 ± 4,22 42,71 ± 3,73 Липазы, ед/л 118,92 ± 7,14 121,33 ± 8,67 120,08 ±9,13 Амилаза, ед/л 168,32 ± 13,14 163,02 ± 10,45 165,06 ± 10,69 **P < 0,01, ***P < 0,001 между группами Table 3 Serum biochemical parameters of animals from the control and experimental groups Parameter Groups Control AH CAH ALT, units/l 45.43 ± 6.24 121.23 ± 21.37*** 91.75 ± 11.32** AST, units/l 38.74 ± 3.41 75.69 ± 5.97*** 61.47± 4.21** ALP, units/l 69.90 ± 4.15 108.90 ± 13.28*** 94.54 ±9.37** GGT, units/l 6.73 ± 0.51 9.67 ± 0.78*** 8.45 ± 0.76** Total Protein, g / dl 6.05 ± 0.61 4.98 ± 0.33** 4.85 ± 0.42** Albumin, g/dl 3.38 ± 0.27 1.89 ± 0.22** 1.87 ± 0.25** Globulin, μmol/l 2.66 ± 0.53 3.10 ±0.31*** 2.98 ± 0.43** A / G 1.32± 0.29 0.63± 0.11** 0.61± 0.13** Total. Bilirubin, μmol/l 4.07± 0.42 5.53± 0.32*** 5.04± 0.48** Urea, μmol/l 5.71 ± 0.52 4.72 ± 0.57** 4.48 ± 0.44** Glucose, mg/dl 4.10 ± 0.53 4.16 ± 0.39 4.13 ± 0.23 Creatinine, μmol/l 38.92 ± 2.91 40.11 ± 4.22 42.71 ± 3.73 Lipases, units/l 118.92 ± 7.14 121.33 ± 8.67 120.08 ±9.13 Amylase, units/l 168.32 ± 13.14 163.02 ± 10.45 165.06 ± 10.69 **P<0.01, ***P<0.001 significance difference between groups Ультразвуковое исследование брюшной полости. Нормальная эхоструктура печени наблюдалась у собак с ОГ (n = 5) и ХАГ (n = 4), а также у животных контрольной группой (n = 12). Гипоэхогенность паренхимы печени вместе с дилатацией кровеносных сосудов печени наблюдалась у десяти животных (n = 10) в группе ОГ. У остальных животных с ХАГ (n = 11) была определена комбинация гипо- и гиперэхогенности паренхимы печени и утолщение стенок желчного пузыря (рис. 1). а б в Рис. 1. Результаты ультразвукового исследования: а - печеночная паренхима с нормальной эхогенностью; б - острый гепатит: снижение печеночной паренхиматозной эхогенности с появлением «звездного неба». Стенки воротной вены более выражены (стрелка); в - хронический активный гепатит: сочетание гипо- и гиперэхогенности (круг), снижение визуализации кровеносных сосудов печени и утолщение стенок желчного пузыря (стрелка) Fig. 1. Ultrasound results: a -hepatic parenchyma with normal echogenicity; б - Acute hepatitis: reduced hepatic parenchymal echogenicity with «starry sky» appearance and the portal vein walls appeared more prominent (arrow); в - Chronic active hepatitis: a combination of hypo and hyper hepatic echogenicity (circle), reduced visualization of hepatic blood vessels, and gallbladder wall thickening (arrow) Результаты гистологического исследования. Анализ образцов печени, полученных от контрольной группы, выявил нормальную гистологическую архитектуру паренхимы, в то время как в группе ОГ были определены гепатоцеллюлярный некроз и апоптоз с преимущественной инфильтрацией нейтрофильных клеток. Кроме того, у собак с ХАГ была выявлена некровоспалительная активность и смешанная инфильтрация воспалительных клеток (лимфоциты и плазматические клетки) в области портала и паренхимы вместе с заживлением дегенерированных гепатоцитов в некоторых областях путем отложения фиброзной ткани, которая идентифицирована как красный окрашенный фибриллярный коллаген (типы I и III) по красному пятну Picrosirius red (рис. 2). г д е Рис. 2. Гистологические исследования: а - здоровые животные: нормальная печеночная паренхима с сохраненной долевой структурой; б, в - острый гепатит: диффузный гепатоцеллюлярный апоптоз, некроз вместе с нейтрофильной инфильтрацией (б, стрелки), а также апоптотический гепатоцит (наконечник стрелки); г - е - хронический активный гепатит: частичный некроз гепатоцитов, умеренная инфильтрация мононуклеарных воспалительных клеток (наконечник стрелки), гиперпластическая итоклетка (звездочки), и связан с резидентными фибробластами печени и прецирротическим отложением интерстициальной и портальной фиброколлагеновой ткани (г, д, стрелки), которые идентифицированы как коллагеновые волокна (типы I и III) (е, стрелки) Fig. 2. Histological inspection: a - Healthy animals: normal hepatic parenchyma with preserved lobular structure; б, в - Acute hepatitis: diffuse hepatocellular apaptosis, necrosis together with neutrophiles infiltration (б, arrows) as well as apoptotic hepatocyte (arrow head); г - е - Chronic active hepatitis: piecemeal necrosis of hepatocytes, moderate infiltration of mononuclear inflammatory cell (arrow head), hyperplasic ito cell (asterstiks), and is associated with liver resident fibroblasts and pre-cirrhotic deposition of interstitial and portal fibrocollagenous tissue (г, д, arrows) that identified as collagen fibers (types I and III) (е, arrows) Профиль экспрессии гепатоцитов полученных cfa-микроРНК. Как показано на рис. 3, а cfa-miR-122 был значительно экспрессирован в сыворотке собак с ОГ (изменение медианного сгиба - 9,48) по сравнению с ХАГ (P < 0,05) и контрольной группой (P < 0,001) cfa-miR-122 был значительно экспрессирован в сыворотке собак с ХАГ (изменение среднего сгиба - 4,94, P < 0,01) по отношению к контролю. Как показано на рис. 3, б cfa-miR-21 сверхэкспрессирован только в сыворотке собак с ХАГ (изменение среднего сгиба - 10,57, P < 0,001) по сравнению с ОГ и контрольной группой. а б Рис. 3. Сравнение уровня экспрессии cfa-miR-122 (а) и cfa-miR-21 (б) в сыворотке крови собак. Fold change (изменение среднего сгиба), control (контроль), AH (ОГ), CAH (ХАГ). *P < 0,05, **P < 0,01, *** P < 0,001 между группами Fig. 3. Comparison of expression level of cfa-miR-122 [a] and cfa-miR-21 [б] in serum of dogs. *P < 0.05,**P < 0.01,***P < 0.001 significant differences between groups Анализ кривой ROC дифференциально экспрессированных cfa-микроРНК. Анализ кривой ROC показал, что cfa-miR-122 можно использовать в качестве нового диагностического биомаркера для дифферринциальной диагностики ОГ и ХАГ от контрольной группы, где AUC был 0,98 (95 % CI 0,95…1,0, P < 0,0001) для ОГ и 0.96 (95 % CI 0,90…1,0, P < 0,001) для ХАГ, с высокой чувствительностью и специфичностью 91,7 и 91,7 % при срезе 1,79, 83,3 и 91,7 % при срезе 1,64 соответственно (рис. 4, а, в). Более того, при AUC0.85 (95 % CI 0,68…1,0, P < 0,01) cfa-miR-122 проявил потенциальную роль в дифференцировании ОГ от группы ХАГ с чувствительностью 83,3 и специфичностью 91,7 при срезе 6.46 (рис. 4, б). С другой стороны, сывороточный cfa-miR-21 с AUC0,99 (95 % CI 0,95…1,0, P < 0,0001) и 0,88 (95 % CI 0,73…1,0, P < 0,01) показал потенциальную роль в дифференциации группы ХАГ от контрольной и от группы с ОГ соответственно (рис. 4, в и г), где оптимальная чувствительность и специфичность были 83,3 и 100 % при срезе 1,51, 85 и 91,7 % при срезе 1,84 соответственно. а б в г Рис. 4. Анализ ROC кривой cfa-miR-122 между ОГ и контрольной группой (а), а также группа ОГ и ХАГ (б). Анализ кривой ROC cfa-miR-122 и 21 между ХАГ и контрольной группой (в). Анализ кривой ROC cfa-miR-21 между ХАГ и ОГ (г). Sensitivity - чувствительность; 1 - specificity - специфичность Fig. 4. ROC curve analysis of cfa-miR-122 among AH and the control group [а] as well as AH and CAH group [б]. ROC curve of cfa-miR-122 and 21 among CAH and the control group [в]. ROC curve analysis of cfa-miR-21 among CAH and AH group [г] Обсуждение Проведенные нами исследования показали, что по возрасту и массе тела у наблюдаемых животных полученный результат согласуется с данными [1, 7, 16]. При этом отмечено, что обе изучаемые формы первичного гепатита более ярко выражены у взрослых особей породы лабрадор ретривер и русский той-терьер, что связано с породоспецифическими особенностями метаболизма. У исследованных животных наблюдались неспецифические клинические признаки, включая рвоту и анорексию, которые возможно связаны с более низкой способностью печени выводить токсины, влияющие на рвотные хеморецепторы, что влечет за собой потерю питательных веществ и снижение массы тела у собак с ОГ и ХАГ по сравнению с контролем. Ультразвуковое исследование позволило установить почечную недостаточность у большинства собак группы ОГ, что может быть связано с застойными явлениями в печени из-за некровоспалительной активности [6, 16, 17]. Однако у большинства животных с ХАГ, УЗИ показало сочетание гипо- и гиперэхогенности, что может быть связано с одновременной воспалительной активностью печени и фиброзом [6, 17]. С другой стороны, нормальная эхоструктура печени при УЗИ собак, у которых гистологически подтверждено наличие ОГ и ХАГ, свидетельствует о низкой чувствительности УЗИ как метода идентификации и дифференциации. Определение печеночных ферментов (AЛT, ACT, ЩФ и ГГT) - наиболее чувствительный и надежный метод диагностики гепатопатологий [16, 18]. В наших исследованиях мы отмечали значительное увеличение ферментов печени, а также О. Билирубина и глобулина в крови у собак с первичним гепатитом, что возможно связано с большой потерей целостности мембран клеток гепатоцитов и диффузной некровоспалительной активностью печеночной паренхимы. Кроме того, анализ показателей метаболической функции печени (общий белок, альбумин, мочевина и отношения A/Г) позволил выявить значительное снижение функциональной активности печени и значительное повреждение гепатоцитов, поскольку они снизились у собак с ОГ или ХАГ по сравнению с контрольной группой [1, 2, 18]. Незначительное изменение уровня креатинина в сыворотке, а также активность амилазы и липазы у животных с первичным гепатитом по сравнению с контролем позволили исключить заболевания почек и поджелудочной железы. К сожалению, анализ биохимических показателей не может с полной достоверностью указывать на наличие ОГ или ХАГ, поскольку они значительно изменились в обеих группах. В настоящее время появляются новые данные, свидетельствующие о том, что микроРНК подходят для диагностики раннего повреждения печени, поскольку они действуют тождественно механизму провоспалительных и профиброзных медиаторов на различных стадиях молекулярного уровня патологий печени [8, 10, 13]. Нами была доказана эффективность cfa-miR-122 в качестве раннего точного биомаркера первичного гепатита, поскольку он стабильно и значительно экспрессируется раньше, чем АЛТ, в сыворотке собак с ПГ, что связано с активной ролью miR-122 во влиянии гепатоцеллюлярного некровоспаления и апоптоза у собак [2, 9, 10, 13]. Следует отметить, что miR-21 в сыворотке был значительно повышен при ХАГ и имел диагностическую значимость при дифференцировании ХАГ от ОГ и контрольной группы в виде прогрессирования фиброза через TGF-β-активированный путь первичных HSCs и связанные с фиброзом гены (α-SMA, Col1A1 и FN1) вызывающие понижение miR-122 и повышение miR-21 в сыворотке собак с ХАГ [2, 7, 9]. Это связано с тем, что miR-21 действует как одна из главных движущих сил прогрессирования повреждений печени в фиброз, поскольку он косвенно активирует звездчатые клетки печени (HSC) для синтеза внеклеточного матрикса (ECM) посредством активации сигнальных путей TGF-β1/Smads, ERK, PTEN/Akt и NF-κB [11, 13, 19, 20]. Заключение Доказано, что cfa-miR-122 экспрессирован в сыворотке собак с ОГ или ХАГ, в то время как cfa-miR-21 потенциально может быть экспрессирован только в сыворотке собак с ХАГ, связанным с отложением фиброзной ткани. Таким образом, исследование cfa-miR-21 может служить в качестве нового неинвазивного диагностического биомаркера для дифференциации ОГ от ХАГ и для раннего прогнозирования и предотвращение фиброза печени, связанного с циррозом.

About the authors

Ahmed Mohammed Hassan El-Sebaey

Moscow State Academy of Veterinary Medicine and Biotechnology - MVA named K.I. Skryabin; Mansoura University

Author for correspondence.
Email: dr_sebaey@mans.edu.eg
23 Akademika Skryabina st., Moscow, 109472, Russian Federation; 25 El Gomhouria st., Mansoura, 35516, Egypt

Postgraduate student, Department of Diagnostics of Diseases, Therapy, Obstetrics and Animal Reproduction ; assistant lecturer, Department of Clinical Pathology, Faculty of Veterinary Medicine, Mansoura University

Pavel Nikolaevich Abramov

Moscow State Academy of Veterinary Medicine and Biotechnology - MVA named K.I. Skryabin

Email: Abramov_P@inbox.ru
23 Akademika Skryabina st., Moscow, 109472, Russian Federation

Candidate of Veterinary Sciences, Associate professor, Department of Diagnostics of Diseases, Therapy, Obstetrics and Animal Reproduction

Seidfatima Mirovna Borunova

Moscow State Academy of Veterinary Medicine and Biotechnology - MVA named K.I. Skryabin

Email: fatima.borunova@mail.ru
23 Akademika Skryabina st., Moscow, 109472, Russian Federation

Doctor of Biological Sciences, Professor, Department of Diagnostics of Diseases, Therapy, Obstetrics and Animal Reproduction

References

  1. Poldervaart JH, Favier RP, Penning LC, Ingh TVD, Rothuizen J. Primary Hepatitis in Dogs: A Retrospective Review (2002-2006). Journal of Veterinary Internal Medicine. 2009; 23(1): 72-80. doi: 10.1111/j.1939-1676.2008.0215.x.
  2. Dirksen K, Verzijl T, Ingh TVD, Vernooij J, Laan LVD, Burgener I, et al. Hepatocyte-derived microRNAs as sensitive serum biomarkers of hepatocellular injury in Labrador retrievers. The Veterinary Journal. 2016; 211:75-81. doi: 10.1016/j.tvjl.2016.01.010.
  3. Meyer HP, Rothuizen J. History and physical examination. In: Washabau RJ, Day MJ. (eds). Canine & Feline Gastroenterology. St. Louis, MO: Elsevier Saunders; 2013.
  4. Eulenberg VM, Lidbury JA. Hepatic Fibrosis in Dogs. Journal of Veterinary Internal Medicine. 2017; 32(1):26-41. doi: 10.1111/jvim.1489.
  5. Raghu C, Ekena J, Cullen JM, Webb CB, Trepanier LA. Evaluation of potential serum biomarkers of hepatic fibrosis and necroinflammatory activity in dogs with liver disease. Journal of Veterinary Internal Medicine. 2018; 32(3):1009-1018. doi: 10.1111/jvim.15064.
  6. Larson MM. Ultrasound Imaging of the Hepatobiliary System and Pancreas. Veterinary Clinics: Small Animal Practice. 2016; 46(3):453-480. doi: 10.1016/j.cvsm.2015.12.004
  7. Craig SM, Fry JK, Hoffmann AR, Manino P, Heilmann RM, Suchodolski JS, et al. Serum C-reactive protein and S100A12 concentrations in dogs with hepatic disease. Journal of Small Animal Practice. 2016; 57(9):459-464. doi: 10.1111/jsap.12504.
  8. Schueller F, Roy S, Vucur M, Trautwein C, Luedde T, Roderburg C. The Role of miRNAs in the pathophysiology of liver diseases and toxicity. International Journal of Molecular Sciences. 2018; 19(1):261-269. doi: 10.3390/ijms19010261.
  9. Dirksen K, Verzijl T, Grinwis G, Favier R, Penning L, Burgener I, et al. Use of Serum MicroRNAs as Biomarker for Hepatobiliary Diseases in Dogs. Journal of Veterinary Internal Medicine. 2016; 30(6):1816-1823. doi: 10.1111/jvim.14602.
  10. El-Sebaey AM, Abramov PN, Abdelhamid FM. Clinical Characteristics, Serum Biochemical Changes, and Expression Profile of Serum Cfa-miRNAs in Dogs Confirmed to Have Congenital Portosystemic Shunts Accompanied by Liver Pathologies. Veterinary Sciences. 2020; 7(2):35-41. doi: 10.3390/vetsci7020035.
  11. Huang Q, Zhang X, Bai F, Nie J, Wen S, Wei Y, et al. Methyl helicterte ameliorates liver fibrosis by regulating miR-21-mediated ERK and TGF-β1/Smads pathways. International Immunopharmacology. 2019; 66:41-51. doi: 10.1016/j.intimp.2018.11.006.
  12. Feldman AT, Wolfe D. Tissue Processing and Hematoxylin and Eosin Staining. In: Day C. (ed). Histopathology. Methods in Molecular Biology (Methods and Protocols). Vol. 1180. New York: Humana Press; 2014. p. 31-43. doi: 10.1007/978-1-4939-1050-2_3.
  13. El-Sebaey AM, Abramov PN. Circulating hepatocyte derived microRNA as a diagnostic biomarker of gallstone disease in dogs. Veterinarian. 2020; 2:64-73. (In Russ). doi: 10.33632/1998-698Х. 2020-2-64-73
  14. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001; 25(4):402-408. doi: 10.1006/meth.2001.1262.
  15. Kirkwood BR, Sterne JAC. Essential Medical Statistics. 2nd ed. Oxford: Blackwell; 2003.
  16. Eman SR, Kubesy AA, Baraka TA, Torad FA, Shaymaa IS, Mohammed FF. Evaluation of hepatocytederived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs. Veterinary World. 2018;11(5):667-673. doi: 10.14202/vetworld.2018.667-673.
  17. Slivinska LG, Maksymovych IA, Leno MI, Rusyn VI, Chernushkin BO, Rij MB. Visual diagnostics of liver diseases in dogs. Uchenye zapiski UO VGAVM. 2017; 53(2):138-142.
  18. Bazhibina EB. Algorithm for the diagnostic study of animals with hyperbilirubinemia. Russian veterinary journal. Small domestic and wild animals. 2013; 5(1):29-32.
  19. Zhao J, Tang N, Wu K, Dai W, Ye C, Shi J, et al. MiR-21 simultaneously regulates ERK1 signaling in HSC activation and hepatocyte EMT in hepatic fibrosis. PLoS ONE. 2014; 9(10): e108005. doi: 10.1371/ journal.pone.0108005.
  20. Szabo G, Bala S. MicroRNAs in liver disease. Nature Reviews Gastroenterology and Hepatology. 2013; 10(9):542-552. doi: 10.1038/nrgastro.2013.87.

Statistics

Views

Abstract - 132

PDF (Russian) - 38

Cited-By


PlumX

Dimensions


Copyright (c) 2020 El-Sebaey A.M., Abramov P.N., Borunova S.M.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies