Phylogenetic analysis and designing new primers for molecular identification of Drosophila suzukii

Cover Page

Abstract


The family Drosophilidae includes over 3750 species worldwide and over 2000 of these are species of Drosophila. Spotted wing drosophila (SWD), Drosophila suzukii is one of the most dangerous species in this family. The insects live on undamaged ripening fruits, using its peculiar serrated ovipositor to break the skin of fresh ripening fruits and lay eggs in it. Drosophila species are very difficult and practically impossible to detect at larval stages. The present investigation was conducted at the All-Russian Plant Quarantine Center and Agrarian and Technological Institute of RUDN University, Moscow, Russia in 2018—2020. The aim of this study was to investigate the method of accurate and rapid identification of D. suzukii, and to design specific primer pairs for pest identification by Real-Time PCR method. The real-time quantitative PCR is a fast, sensitive, repeatable and accurate method for quantifying gene transcript levels. In this study, we designed specific primers (4.Dsuz.FRP) for Real-Time PCR to identify D. suzukii from other relative species. Although D. suzukii is absent in the Russian Federation and has not been reported so far, the project could be a precautionary measure.


Full Text

Introduction

The spotted wing Drosophila (SWD), Drosophila suzukii, was originally described by Matsumura in Japan in 1931 [1]. Members of the Drosophila genus are not generally considered pests since their larvae are primarily developed on damaged or rotting fruits. Nevertheless, D.suzukii infests healthy ripening fruits while still on the plant. Drosophila suzukii larvae devour the fruit pulp within the fruits rendering them unmarketable and reducing the processed fruit exceptional [2, 3]. Furthermore, the wounds created at the infested fruits throughout ovipositing provide access to secondary fungal or bacterial infections leading to additional fruit tissue disintegrate [4—8]. Drosophila suzukii includes exceptional kinds of hosts; for this reason, this type of agricultural pest has come to be a world major pest (Fig. 1) of a large variety of commercial fruit crops [9, 10]. The aim of the research was to molecularly become aware of and draw a phylogenetic tree for Drosophila suzukii and distinguish it from other species.

Fig. 1. Worldwide-confirmed distribution of D. suzukii (August 2020) [11]. 
(https://www.cabi.org/isc/datasheet/109283#toDistributionMaps)

The principal purpose of this study was to categorize the molecular species of D. suzukii. Our purpose was to create an accurate and unique identity technique based on primers designed for D. suzukii, this approach is rapid and more efficient than techniques based totally on morphological identity [5, 12, 13]. The polymerase chain reaction turned into created to discover insects as a reliable and price-effective approach. In addition, in various molecular identification methods, one of the most important parts is the primer design. In this project, we design a specific pair of primers based on Real-time PCR.

Materials and Methods

DNA was extracted from the material under project (insect and larvae, from laboratory collection) by treating the specimens with Proteinase K accompanied with removal of proteins with no extraction with natural solvents and using «DNA Extran-2 Kit», set № NG-511-100 («Synthol», Russian Federation) according to manufacturer’s instructions.

PCR-products purification. A 1:1 volume of Binding Buffer was added to the completed PCR mixture (e. g. 100 µL of Binding Buffer per every 100 µL of the reaction mixture) and mixed thoroughly. Then the solution was transferred up to the GeneJET purification column, centrifuged for 30…60 s. The flow-through solution was discarded. 700 µL of Wash Buffer was added to the GeneJET purification column and centrifuged for 30…60 s. The flow-through was discarded. The purification column was placed back into the collection tube. Then the empty GeneJET purification column was centrifuged for 1 min. After that the GeneJET purification column was transferred to a clean 1.5 mL microcentrifuged tube. Then 50 µL of Elution Buffer was added to the center of the GeneJET purification column membrane and centrifuged for 1 min.

Sequencing. DNA extracts were quantified on a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific Inc., USA). Sequencing was done according to the generally accepted protocol with the use of Genetic Analyzer AB-3500 (Applied Biosystems, USA).

The Drosophila spp. primers, S1859, and A2191 are targeting several Drosophila species and generate an amplicon of 220-bp length. PCR conditions had been identified for each primer pairs: each 25 µL response protected 2 µl of DNA extract (10 pmol), 5x PCR grasp mix, and display-blend (HS-5x), zero.5 µM each primer, 17 µl water.

Primer S1859 (5′-GGAACAGGATGAACAGTTTAACCGCC-3′) as a forward and A2191 (5́-CCCGGTAAAATTAAAATATAAACTTC-3́) as a reverse were used (Table 1) and, in a VeritiTM thermocycler (Applied Biosystems, USA). The reaction mixture was as follows: ready-to-use PCR mixture Screen Mix-HS (Evrogen, Russia). PCR conditions: denaturation at 95 °C for 90 Sec was followed by 39 cycles, including 30 sec at 90 °C; primer annealing at 61 °C for 15 sec; elongation at 72 °C for 30 sec; final elongation at 72 °C for 5 min (Table 2).

Table 1. Primers for the identification of Drosophila spp.

Target genes

Primer

Primer sequence (5´‑3´)

 

 

Drosophila spp.

S1859

5′‑GGAACAGGATGAACAGTTTAACCGCC‑3′

Bogdanowicz et al. [14]

2000

Drosophila spp.

A2191

5’‑CCCGGTAAAATTAAAATATAAACTTC‑3’

Bogdanowicz et al. [14]

2000

Table 2. A list of sequences for identification of Drosophila suzukii with Real‑time PCR

No

Species

Country:
(Data from laboratory of Russian Plant Quarantine Center)

Result of real‑time PCR

1

2

3

4

5

6

7

8

9

10

11

12

13

Drosophila suzukii

Drosophila suzukii

Drosophila melanogaster

Drosophila simulans

Drosophila persimilis

Drosophila rhopaloa

Drosophila kikkawai

Drosophila ficusphila

Drosophila erecta

Drosophila obscura

Drosophila yakuba

K‑ extraction

K‑ amplification

Egypt

Turkey

Turkey

Canada

USA

Japan

China

Japan

Brazil

Japan

USA

 

Water

+

+

 

 

 

 

 

 

 

 

 

 

+

 

Primer design for Real-time PCR, for the identification of Drosophila suzukii. Primer 4.Dsuz.F (5- CCTTCGTGAAGCCTTCTACCG –3́) as a forward and 4.Dsuz.R (5-́ GCA*********AGATC –3)́ as a reverse and 4.Dsuz.Probe (5- CAA*********TTCGCTG –3́) as a probe were used. 1µl (10 pmol) of each primer, 5 μl of master-mix 5dd (HS-5x), 16 μl H2O and 1 μl DNA were used to make PCR mixture. The total volume of 25 μl, in a CFX 96 (Bio Rad, USA), was maintained and run-in Real-Time PCR unit. The reaction mixture was ready-to-use PCR mixture Screen-Mix (Evrogen, Russia) with the following procedure: 94 °C for 5 min, followed by 39 cycles of 95 °C for 30 s, 58 °C for 15 s, and 72 °C for 30 s. After the amplification, a melting curve analysis was performed, and the results had been averaged.

Results and Discussion

D. suzukii has a wide range of hosts both in its native habitats in Asia and the United States, with small fruits and cherries being the main economic concerns [1, 15—17]. Significant damage has been observed in several commercial soft fruits, such as blackberries, blueberries, cherries, raspberries, strawberries, tomatoes, grapes, cherries, figs, kiwis [18—20].

As shown in the phylogenetic tree (fig. 2), D.suzukii family members, such as D. simulans and D. melanogaster, are very close in genetic code, making it more difficult to identify. Moreover, this further highlights the need to design proprietary primers.

Finally, we recommend this primer to other researchers (Table 3).

In this study, we have developed a Real-time PCR assay for the detection and identification of D. suzukii (Fig. 3).

In these results, we designed the primers 4.Dsuz.F (5- CCTTCGTGAAGCCTTCTACCG –3)́ as a forward and 4.Dsuz.R (5́- GCA*********AGATC –3́) as a reverse and 4.Dsuz. Probe (5- CAA*********TTCGCTG –3)́ as a probe. In addition, we had nine samples for identification with originally designed primer (4.Dsuz) and we had only two positives of Drosophila suzukii as the positive control, 9 unknown cases, their names are listed in Table 1, respectively.

In addition, there is a case of the negative control (sample 3 up to 11) for checking PCR and extraction DNA processes. Two were accurately identified as Drosophila suzukii; two samples (number: 1, from Egypt and number: 2 from Turkey) showed melt peaks in the acceptable range of T: 58 ºC results for and were clearly distinguished from another species. No other melt peaks were reported.

Fig. 2. Phylogenetic tree for Drosophila spp.

Table 3. Identification of different Drosophila suzukii genetic codes

No

Species

Number of letters

99

101

114

119

123

140

141

143

160

165

171

181

1

Drosophila suzukii

T

C

C

T

C

T

C

C

C

C

T

A

2

Drosophila simulans

C

T

T

C

T

G

T

G

C

T

C

T

3

Drosophila melanogaster

A

T

C

T

C

T

T

A

T

T

C

T

4

Drosophila persimilis

C

T

T

C

T

G

T

G

C

T

C

T

5

Drosophila rhopaloa

C

T

T

C

T

G

T

G

C

T

C

T

6

Drosophila ficusphila

A

T

C

T

G

T

T

C

T

T

C

T

7

Drosophila kikkawai

G

T

C

T

G

T

T

A

T

T

C

T

8

Drosophila erecta

C

T

T

C

T

G

T

G

C

T

C

T

9

Drosophila yakuba

C

T

T

C

T

G

T

G

C

T

C

T

9

Drosophila obscura

G

T

C

T

T

T

T

C

T

T

C

T

 

Fig. 3. The efficiency of the real-time PCR assay for the identification of D. suzukii

The research has proven that particular host fruits were preferred for ovipositing and development of larvae, at the same time as temperature performed an essential position in D. suzukii development, survival, and fecundity. We have used unique sequences in all stages and the primers were designed for the first time as well.

The primary comparison for the results of the sequence with the GeneBank genetic sequence database was performed by the NCBI BLAST web site (http://www.ncbi. nlm.nih.gov/BLAST). BioEdit v.7.0.5.3 [18] sequence alignment editor was used for sequence checking, alignment, and editing.

Conclusion

Molecular identification for all samples used within the improvement of the technique changed into done by way of PCR amplification. For a long time, polymerase chain reaction (PCR) methods had been used to classify pests, organisms and sicknesses around the sector. The outcomes showed that those primers appropriately diagnosed the gene region in addition to the specific region of D. suzukii. When samples are not sufficient for morphological identification or handiest immature samples are available, real-time PCR molecular detection may be used as a fast and efficient detection approach. For such an economically vital attacker, a one-of-a-kind identification method can also permit extra accurate tracking and detection and save you misidentification. Real-time PCR detection can be used as a fast and efficient detection device. Finally, a phylogenetic tree turned into identified for numerous specimens close to D. suzukii. As an end result, it is far located near the subspecies in the tree.

About the authors

Yousef Naserzadeh

Peoples’ Friendship University of Russia

Author for correspondence.
Email: unaserzadeh@gmail.com
ORCID iD: 0000-0003-2585-5307
8/2 Miklukho-Maklaya st., Moscow, 117198, Russian Federation

PhD candidate, Department of Agrobiotechnology, Agrarian and Technological Institute

Galina Nikolaevna Bondarenko

All-Russian Plant Quarantine Center

Email: galine1988@yandex.ru
32, Pogranichnaya st., Bykovo, Ramensky district, Moscow region, 140150, Russian Federation

Candidate of Biological Sciences

Ekaterina Vladimirovna Kolesnikova

All-Russian Plant Quarantine Center

Email: reseachergm@mail.ru
32, Pogranichnaya st., Bykovo, Ramensky district, Moscow region, 140150, Russian Federation

Elena Nikolaevna Pakina

Peoples’ Friendship University of Russia

Email: e-pakina@yandex.ru
8/2 Miklukho-Maklaya st., Moscow, 117198, Russian Federation

Candidate of Biological Sciences, Associate Professor, Department of Agrobiotechnology, Agrarian and Technological Institute

References

  1. Asplen MK, Anfora G, Biondi A, Choi DS, Chu D, Daane KM, et al. Invasion biology of spotted wing Drosophila (Drosophila suzukii): a global perspective and future priorities. Journal of Pest Science. 2015; 88(3):469-494. doi: 10.1007/ s10340-015-0681-z
  2. Walsh DB, Bolda MP, Goodhue RE, Dreves AJ, Lee J, Bruck DJ, et al. Drosophila suzukii (Diptera: Drosophilidae): invasive pest of ripening soft fruit expanding its geographic range and damage potential. Journal of Integrated Pest Management. 2011; 2(1): G1-G7. doi: 10.1603/IPM10010
  3. Rota-Stabelli O, Ometto L, Tait G, Ghirotto S, Kaur R, Drago F, et al. Distinct genotypes and phenotypes in European and American strains of Drosophila suzukii: implications for biology and management of an invasive organism. Journal of Pest Science. 2020; 93(1):77-89. doi: 10.1007/s10340-019-01172-y
  4. Poyet M, Eslin P, Héraude M, Le Roux V, Prévost G, Gibert P, et al. Invasive host for invasive pest: when the A siatic cherry fly (Drosophila suzukii) meets the A merican black cherry (Prunus serotina) in Europe. Agricultural and forest entomology. 2014; 16(3):251-259. doi: 10.1111/afe.12052
  5. Lillesaar C, Gaspar P. Serotonergic Neurons in Vertebrate and Invertebrate Model Organisms (Rodents, Zebrafish, Drosophila melanogaster, Aplysia californica, Caenorhabditis elegans). In: Pilowsky PM. (ed.) Serotonin. Academic Press; 2019. p.49-80. doi: 10.1016/B978-0-12-800050-2.00003-6
  6. Murphy KA, Unruh TR, Zhou LM, Zalom FG, Shearer PW, Beers EH, et al. Using comparative genomics to develop a molecular diagnostic for the identification of an emerging pest Drosophila suzukii. Bulletin of entomological research. 2015; 105(3):364-372. doi: 10.1017/S0007485315000218
  7. Naserzadeh Y, Pakina EN, Nafchi AM, Gadzhikurbanov AS. Specific identification method based on PCR for Drosophila melanogaster. RUDN Journal of Agronomy and Animal Industries. 2020; 15(2):134-142. doi: 10.22363/2312-797X-2020-15-2-134-141.
  8. Lee JC, Bruck DJ, Dreves AJ, Ioriatti C, Vogt H, Baufeld P. In focus: spotted wing drosophila, Drosophila suzukii, across perspectives. Pest management science. 2011; 67(11):1349-1351. doi: 10.1002/ps.2271
  9. Naserzadeh Y, Mahmoudi N, Pakina E, Zargar M. Molecular identification and primer design for spotted wing drosophila (Drosophila suzukii). Research on Crops. 2020; 21(2):364-369. doi: 10.31830/23487542.2020.061
  10. Nikolouli K, Sassù F, Mouton L, Stauffer C, Bourtzis K. Combining sterile and incompatible insect techniques for the population suppression of Drosophila suzukii. Journal of pest science. 2020; 93(2):647-661. doi: 10.1007/s10340-020-01199-6
  11. Enriquez T, Ruel D, Charrier M, Colinet H. Effects of fluctuating thermal regimes on cold survival and life history traits of the spotted wing Drosophila (Drosophila suzukii). Insect Science. 2020; 27(2):317-335. doi: 10.1111/1744-7917.12649
  12. Taning CN, Christiaens O, Berkvens N, Casteels H, Maes M, Smagghe G. Oral RNAi to control Drosophila suzukii: laboratory testing against larval and adult stages. Journal of pest science. 2016; 89(3):803-814. doi: 10.1007/s10340-016-0736-9
  13. Durkin SM, Chakraborty M, Abrieux A, Lewald KM, Gadau A, Svetec N, Peng J, Kopyto M, Langer CB, Chiu JC, Emerson JJ, Zhao L. Behavioral and Genomic Sensory Adaptations Underlying the Pest Activity of Drosophila suzukii. Molecular biology and evolution. 2021 May 19;38(6):2532-2546. doi: 10.1093/molbev/ msab048
  14. Bogdanowicz SM, Schaefer PW, Harrison RG. Mitochondrial DNA variation among worldwide populations of gypsy moths, Lymantria dispar. Molecular phylogenetics and evolution. 2000; 15(3):487-495. doi: 10.1006/mpev.1999.0744
  15. Naserzadeh Y, Bondarenko G, Kolesnikova E, Zargar M, Pakina E, Engeribo A. Molecular identification and design of specific primer for quarantine fruit fly (Drosophila suzukii). Research on Crops. 2020 Sep 1;21(3). doi: 10.31830/2348-7542.2020.095
  16. Cattel J, Kaur R, Gibert P, Martinez J, Fraimout A, Jiggins F, et al. Wolbachia in European populations of the invasive pest Drosophila suzukii: regional variation in infection frequencies. PLoS One. 2016;11(1): e0147766. doi: 10.1371/journal.pone.0147766
  17. Biganski S, Fückel S, Jehle JA, Kleespies RG. Infection effects of the new microsporidian species Tubulinosema suzukii on its host Drosophila suzukii. Scientific Reports. 2021;11(1):10151. doi: 10.1038/s41598021-89583-9
  18. Varón-González C, Fraimout A, Debat V. Drosophila suzukii wing spot size is robust to developmental temperature. Ecology and Evolution. 2020;10(7):3178-3188. doi: 10.1002/ece3.5902
  19. Ulmer R, Couty A, Eslin P, Gabola F, Chabrerie O. The firethorn (Pyracantha coccinea), a promising dead-end trap plant for the biological control of the spotted-wing Drosophila (Drosophila suzukii). Biological Control. 2020;150:104345. doi: 10.1016/j.biocontrol.2020.104345
  20. Maino JL, Schouten R, Umina P. Predicting the global invasion of Drosophila suzukii to improve Australian biosecurity preparedness. Journal of Applied Ecology. 2021 Apr;58(4):789-800. doi: 10.1111/1365- 2664.13812

Supplementary files

Supplementary Files Action
1.
Fig. 1. Worldwide-confirmed distribution of D. suzukii (August 2020)

View (24KB) Indexing metadata
2.
Fig. 2. Phylogenetic tree for Drosophila spp.

View (66KB) Indexing metadata
3.
Fig. 3. The efficiency of the real-time PCR assay for the identification of D. suzukii

View (13KB) Indexing metadata

Statistics

Views

Abstract - 416

PDF (English) - 108

Cited-By


PlumX

Dimensions


Copyright (c) 2021 Naserzadeh Y., Bondarenko G.N., Kolesnikova E.V., Pakina E.N.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies