Molecular analysis of gibberellin receptor gene GID1 in Dasypyrum villosum and development of DNA marker for its identification

Cover Page
  • Authors: Razumova O.V.1,2, Bazhenov M.S.1, Nikitina E.A.1, Nazarova L.A.1, Romanov D.V.1, Chernook A.G.1, Sokolov P.A.3, Kuznetsova V.M.1, Semenov O.G.4, Karlov G.I.1,3, Kharchenko P.N.1, Divashuk M.G.1,3
  • Affiliations:
    1. All-Russia Research Institute of Agricultural Biotechnology
    2. Moscow Botanical Garden of Academy of Sciences
    3. Russian State Agrarian University - Moscow Timiryazev Agricultural Academy
    4. Рeoples’ Friendship University of Russia (RUDN University)
  • Issue: Vol 15, No 1 (2020)
  • Pages: 62-85
  • Section: Genetics and plant breeding
  • URL: http://agrojournal.rudn.ru/agronomy/article/view/19544
  • DOI: https://doi.org/10.22363/2312-797X-2020-15-1-62-85
  • Cite item

Abstract


Dasypyrum villosum is an annual cereal used as a donor of agronomic traits for wheat. Productivity is one of the most important traits that breeding is aimed at. It is a very complex trait, the formation of which is influenced by many different factors, both internal (the genotype of the plant) and external. The genes responsible for the gibberellin sensitivity played a large role in multiplying yields of cereal crops. Another such gene is the Gid1, which encodes a receptor for gibberellins. This article compares the DNA sequences of the Gid1 gene obtained from six Dasypyrum villosum samples. Using a sequence of wheat and rye taken from the GenBank database (NCBI), we selected primers for regions of different genomes (A, B, and D subgenomes of wheat and the R genome of rye), and carried out a polymerase chain reaction on D. villosum accessions of diverse geographical origin. The resulting PCR product was sequenced by an NGS method. Based on the assembled sequences, DNA markers have been created that make it possible to differentiate these genes of the V genome and homologous genes of wheat origin. Using monosomic addition, substitution, and translocation wheat lines, the localization of the Gid1 gene of D. villosum was established on the long arm of the first V chromosome. A phenotypic assessment of common wheat lines carrying substituted, translocated, or added D. villosum chromosomes in their karyotype was performed. Tendency of disappearance of the first chromosome of D. villosum in the lines with added chromosomes was revealed.


Full Text

Introduction Common wheat (Triticum aestivum 2n = 6x = 42) is one of the world’s major crops. According to the FAO1, in 2019, world wheat production was estimated at 766 million tons, which was a record high. However, considering the need to provide products for the growing population, wheat productivity should have been increased by 4 to 76% by 2050, according to various forecasts [1]. It is the increase in productivity, and not the expansion of sown areas, that is recognized as the optimal strategy for ensuring food security worldwide. One way to increase productivity is to use wild varieties to transmit valuable agronomic genes to elite crops. Dasypyrum villosum (2n = 2x = 14, VV) is an annual cereal of Triticeae family, it grows in mid-sea region, southwestern Asia and Russia. Species of Dasypyrum genus have approved themselves as a reliable source of resistance genes to biotic [2, 3] and abiotic [4] stress. As a rule, gene transfer from Dasypyrum to common wheat occurs through the use of lines with substituted or translocated chromosomes [5-7]; this method has been widely used from the end of the last century to the present day [8-12]. The influence of short-stem genes on wheat productivity has been shown in a number of studies [13, 14]. Moreover, one of the key factors behind the so-called ‘green revolution’ in agriculture was creation of dwarf wheat varieties using Rht (Reduced height) dwarfing genes [15, 16]. In addition to reducing yield losses due to lodging resistance, dwarfing 1 Cereal production in the world can reach a record level in 2019. Food and Agriculture Organization of the United Nations. Available from: http://www.fao.org/worldfoodsituation/csdb/ru/ [Accessed 17 December 2019] genes contribute to increased productivity due to better redistribution of assimilates in favor of spike and reduced sprouting due to impaired synthesis of gibberellins or sensitivity to these phytohormones, which play a key role in a wide range of plant growth and development processes, including of fruit and seed formation [17]. Low plant height can be achieved in different ways; however, one of the key factors is a complex interaction of DELLA proteins with other proteins and gibberellins. The Gid1 gene (Gibberellin Insensitive Dwarf 1) encodes a protein that is a receptor for gibberellins. Active forms of gibberellins, joining the GID1 receptor, changes its conformation so that it acquires ability to bind to DELLA proteins. By binding to GID1, DELLA proteins are modified by ubiquitin and destroyed by proteasome, which promotes plant growth. Absence of binding, for any reason, leads to accumulation of DELLA proteins and loss of plant sensitivity to giberrellic acid [17, 18]. Thus, in order to reduce plant growth by altering the components of the gibberellin-GID1-DELLA system, it is necessary to increase stability of DELLA proteins. One of the possible ways to achieve this goal is to influence the Gid1 gene to reduce DELLA binding capabilities, which demonstrates the need for a deeper study of allelic variants of these genes in wheat and its wild varieties. The aim of our work was sequencing of the Gid1 gene sequences affecting plant height in two Dasypyrum villosum accessions, determining its localization on chromosomes and creating a DNA marker for differentiation of wheat genes and D. villosum genes. Materials and methods The Gid1 gene was sequenced using two accessions of Dasypyrum villosum obtained from the collection of the Western Regional Plant Introduction Station, Washington State University (W621717, PI 598390). To map genes onto chromosomes, we used a series of monosomic, addition substitution, and translocation lines of common wheat cv. Chinese spring obtained from Nanjing Agricultural University (NAU), as well as kindly provided by Dr. W. Jon Raupp of Wheat Genetics Resource Center Kansas Wheat Innovation Center, Kansas State University (KSU) and Adam J. Lukaszewski (AJL), Professor of Genetics Dept. of Botany & Plant Sciences University of California (Table 1). Studied wheat lines with Dasypyrum villosum genetic material Table 1 Accession number Aberration Chromosome Chromosome source Origin Author 7677 addition 1V#3 Sicilian KSU AJL 7679 addition 3V#3 Sicilian KSU AJL 7680 addition 4V#3 Sicilian KSU AJL 7681 addition 5V#3 Sicilian KSU AJL 7682 addition 6V#3 Sicilian KSU AJL 7683 addition 7V#3 Sicilian KSU AJL 7509 addition 1V#1 Italian KSU Sears 7510 addition 2V#1 Greek KSU Sears 7511 addition 4V#1 Greek KSU Sears 7512 addition 5V#1 Greek KSU Sears Сontinuation table 1 Accession number Aberration Chromosome Chromosome source Origin Author 7513 addition 6V#1 Italian KSU Sears 7514 addition 7V#1 Italian KSU Sears 3891/89 substitution 1V(1A) Italian AJL AJL 86/11 substitution 3V(3B) Sicilian AJL AJL 1360/07 substitution 3V(3D) Sicilian AJL AJL 2333/89 substitution 5V(5D) Sicilian AJL AJL 1411/94 substitution 6V(6B) Sicilian AJL AJL 1415/94 substitution 6V(6A) Sicilian AJL AJL 3889/89 substitution 7V(7A) Italian AJL AJL 6661 substitution 6V#2 [6A CS] Chinese KSU NAU 5585 translocation T6AL·6V#2S T2AS.2AL-2R#3L Chinese KSU NAU 5594 translocation T4DS·4V#3L Sicilian KSU KSU 5595 translocation T4DL·4V#3S Sicilian KSU KSU 5615 translocation T1DS·1V#3L Sicilian KSU KSU 5616 translocation T1DL·1V#3S Sicilian KSU KSU 5634 translocation T2BS·2V#3L Sicilian KSU KSU 5636 translocation T3DL·3V#3S Sicilian KSU KSU 5637 translocation T3DS·3V#3L Sicilian KSU KSU 5638 translocation T5DL·5V#3S Sicilian KSU KSU 5639 translocation T7DL·7V#3S Sicilian KSU KSU 5640 translocation T7DS·7V#3L Sicilian KSU KSU 1438/94 translocation 6BS.6VL Sicilian AJL AJL 3214/96 translocation 6AS.6VL Un know AJL AJL 853/11 translocation 3V.3BL+3B Sicilian AJL AJL Part of the samples with genetic material of D. villosum was grown in the greenhouse of Center for Molecular Biotechnology of Russian Timiryazev State Agrarian University for preliminary assessment of phenotypic effects. Plants were evaluated for such traits as height of the main stem, length of the main spike, tillering and resistance to powdery mildew. Statistical data processing was carried out using Microsoft Excel analysis package, the calculations were performed using the ready-made functions included in the analysis package. 2 DNA was isolated according the CTAB method [19] from young lyophilized dried leaves. Primers were selected in the Primer BLAST NCBI program. The PCR mixture consisted of the following components (concentration of the components in the final mixture): 1 × LR buffer (pH = 9.3), 1.5 mM MgCl , 0.2 mM of each dNTP, 2 μM of each primer, 0.04 units/μl LR Plus polymerase, 0.02 units/μl Taq polymerase, 4 ng/μl template DNA. The volume of the PCR mixture was 25 μl. PCR was performed under the following temperature conditions: 94 °C - 5 min; 36 cycles 94 °C - 30 sec, 58 °C - 30 sec, 72 °C - 2 min; 72 °C - 5 min. The resulting PCR products were analyzed by electrophoresis on a 1.5% agarose gel with TBE buffer supplemented with ethidium bromide. Electrophoregrams were visualized in ultraviolet light using a gel documentation system. PCR products obtained using D. villosum DNA were transferred for NGS sequencing after checking their quality by electrophoresis. Sequencing using Illumina technology was performed at Genomed Company. DNA libraries were prepared using the Swift 2S ™ Turbo DNA Library Kit. During preparation of the DNA library, PCR products obtained from different samples of D. villosum were labeled with individual barcodes. Sequencing was performed on a MiSeq System. After reading barcodes, the sequencing results were obtained for each sample separately. Quality of the sequencing results was evaluated using FastQC software. The contigs were compiled from paired-end reads using SPAdes 3.13.0 software package [20]. To identify polymorphisms present in heterozygous state, the obtained contig sequences were used to map the initial reads on them using SNAP program [21]. Freebayes software (Garrison, 2012) was used to detect single nucleotide polymorphisms and small insertions and deletions. Identified polymorphisms were introduced into the gene sequence using Bcftools (https://github.com/samtools/bcftools), and thus an alternative sequence for each contig was obtained. Alignment of the obtained contigs of the Dasypyrum villosum Gid1 gene to the sequence of the common wheat homolog genes was carried out in GeneDocv2.7 program [22]. To identify Gid1 of Dasypyrum villosum in wheat background, we selected primers (DvGid1-1F: AGGTCAACCGCAACGAGTGC and DvGid1-1R: CCAATCCCACCGTCTCGAGCGTA) for gene regions that were the same in different D. villosum samples but differ from the gene sequences in wheat. 2 Conditions for amplifi ion of DvGid1. The PCR mixture consisted of the following components (concentration of the components in the fi l mixture): 1x Taq buffer (pH = 8.6), 1.5 mM MgCl , 0.2 mM each dNTP, 2 μM each primer, 0.4 units/μl Taq polymerase, 4 ng/μl matrix DNA. The volume of the PCR mixture was 25 μl. PCR was carried out under the following temperature conditions: 94 °C - 5 min; 36 cycles 94 °C - 30 sec, 60 °C - 30 sec, 72 °C - 1 min; 72 °C for 10 min. The resulting PCR products were analyzed by electrophoresis in a 1.5% agarose gel with TBE buffer supplemented with ethidium bromide. Electrophoregrams were visualized in ultraviolet light using a gel documentation system. Results and Discussion Sequencing of the Dasypyrum villosum Gid1 gene. At first, the mRNA sequence of the wheat Gid1 gene (GenBank FR668558) was used to search for this gene in the IWGSCRefSeqv1.0 wheat genome using BLAST 2. The greatest homology to this sequence was shown by the wheat genes TraesCS1B02G265900, TraesCS1D02G254500, TraesCS1A02G255100 related to chromosomes 1B, 1D and 1A, respectively. In EnsemblPlants database, these genes are annotated as encoding the GID1 protein. The genomic sequences of these three genes were exported from the assembly of the wheat genome using a genomic browser3. The sequence of the rye Gid1 gene was found using BLAST in one of the contigs (FKKI010039294, Lo7_v2_contig_60281) of the Lo7 rye genome related to chromosome 1R4. 2 BLAST. Available from: https://wheat-urgi.versailles.inra.fr/Seq-Repository/BLAST. [Accessed 17 December 2019] 3 Available from: https://urgi.versailles.inra.fr/jbrowseiwgsc/gmod_jbrowse [Accessed 17 December 2019 4 Available from: https://webblasVol.ipk-gatersleben.de/ryeselect [Accessed 17 December 2019]] Genome-specific primers and primers for conserved regions of the gene were selected using Primer-BLAST (NCBI)5. Selected primers are given in Table 2. These primers were used to amplify the Gid1 gene on DNA of Dasypyrum villosum W621717 (accession 1), PI 598390 (accession 2). PCR with primers for common wheat subgenome B and for the rye genome gave positive results. Primers for amplification of Gid1 homolog genes, selected based on wheat and rye sequences Table 2 A pair of primers (5’->3’) Tm The expected size of the product, bp GID1-B-F: CCGAGACCGTCCAAAACAATAAAC GID1-B-R: ATCATCAGACAGACAGACGGACA 60 2503 GID1-R-F: CATCCAAGACCGTCCAAAACAAT GID1-R-R: GGCAAACACATGGATGGATACAG 60 2576 Next, the PCR products were sequenced according NGS method and subjected to bioinformatics processing. As a result, we obtained nucleotide sequences of the two D. villosum accessions of different origin, which were compared with each other, as well as with the nucleotide sequences of wheat from the database (Fig. 1). Fig. 1. A part of alignment of the sequences sequence of the Dasypyrum villosum Gid1 gene As a result of alignment, a high degree of homology between the studied sequences was revealed, however, differences were observed in some regions (mainly single and double nucleotide substitutions), which allowed us to develop a marker able to determine the presence of the Dasypyrum Gid1 gene in a wheat background. Marker development. The revealed differences between the nucleotide sequences of the D. villosum Gid1 gene and common wheat homolog allowed the development of the pair of primers (DvGid1-1F: AGGTCAACCGCAACGAGTGC and DVGid1-1R: CCAATCCCACCGTCTCGAGCGTA), allowing specific amplification of the Dasypyrum villosum Gid1 gene fragment and not producing a PCR product from wheat DNA (Fig. 2). 5 Available from: https://www.ncbi.nlm.nih.gov/tools/primer-blast [Accessed 17 December 2019] Fig. 2. Alignment of the partial sequences of the Gid1 gene for common wheat (chr1A, chr1B chr1D) and D. villosum (DvGid1, obtained in the study). Specific primers for detecting the DvGid1 gene are marked in green Using these primers, a 280 bp region was amplified from the D.villosum DNA samples, while the marker fragment was not amplified from the wheat DNA of various varieties (Fig. 3). This marker can further be used to track the transmission of Dasypyrum genetic material in breeding of common wheat. Fig. 3. Electrophoresis of the PCR products obtained using primers DvGid1-1F and DvGid1-1R. Wheat cultivars: 1 - Lebed; 2 - Pamyat; 3 -Etnos; Dasypirum lines: 4-21717; 5-598390; 6-470279 Mapping of the Gid1 gene on Dasypyrum villosum chromosomes. To map the DvGid1 gene on chromosomes, we used a collection of common wheat lines carrying added, substituted, and translocated D. villosum chromosomes. DNA lines with various additions were used for PCR with the developed marker Dv-Gid-1F/R. As a result, the marker was amplified only in accessions 7677 (1V#3), 3891/89 (1V(1A)), 3896/89 (1V(1D)), 5615 (T1DS•1V#3L), bearing the first chromosome of the Dasypyrum V genome; amplification was absent in the rest of accessions (Fig. 4). Fig. 4. М.р.- 100+ bp ladder. Monosomal additional Lines D. villosum: 1-2 - № 7513; 3-4 - № 6661; 5-6 - № 5615; 7-8 - № 5595 As a result of PCR using the DNA of translocated lines 5615 (T1DS•1V#3L) and 5616 (T1DS•1V#3S) carrying in their genomes only the long or short arms of the first chromosome of D. villosum, respectively, amplification was observed only for the line 5615 (T1DS•1V#3L). Thus, we can conclude that the DvGid1 gene is located on the long arm of the first chromosome, and collinear to common wheat genes, also located in the long arm of the chromosomes of the first homeologic group. Phenotypic expression of the DvGid1 gene of Dasypyrum in a wheat background. For preliminary assessment of effect of the Dasypyrum DvGid1 gene on growth and development of wheat, we carried out a phenotypic assessment of lines with substitutions, additions, and translocations (Tables 3, 4). Plants were grown in a greenhouse without vernalization. Due to the fact that the Gid1 gene plays one of the key roles in response to gibberellin, we first evaluated length of the main stem, tillering, and length of the spike. Plant height varied greatly, differing almost twice between individual accessions (from 56 cm in accession 5639 with translocation T7DL•7V#3S to 113 cm in sample 5595 with translocation T4DL•4V#3S). The number of tillers per plant ranged from 1 to 4, and, apparently, was not associated with presence of the DvGid1 gene. The spike length was within 4…7 cm, while size of the main spike and side spikes of the same plant practically did not differ from each other (Tables 3, 4). Phenotypic assessment of the alien chromosome addition wheat lines Table 3 Chromosome Number Average length of main stem Average length of main spike Average total number of tillers DvGid1 1V#3 7677 65.66 ± 2.60 4.00 ± 0.29 1.44 ± 0.29 Yes 3V#3 7679 73.29 ± 4.88 3.43 ± 0.30 1.50 ± 0.29 - 4V#3 7680 84.86 ± 2.61 5.71 ± 0.61 1.71 ± 0.29 - 5V#3 7681 58.38 ± 6.55 6.25 ± 0.62 2.13 ± 0.40 - 6V#1 7513 105.50 ± 2.50 7.00 ± 0.00 3.00 ± 1.00 - 7V#1 7514 87.00 ± 12.00 5.50 ± 0.50 3.50 ± 1.50 - To grow the studied lines, we used either original seeds or seeds verified using molecular markers in previous studies [24]. However, during molecular analysis of individual plants of 7677 line (1V#3), bearing additional 1V chromosome, it was found that a specific marker was not amplified on some plants. Thus, we can say that there is no added chromosome 1V in the studied plants. A similar loss of added chromosomes is a relatively common occurrence. And our results once again emphasize importance of using molecular markers to verify plant material studied. Phenotypic assessment of substitution and translocation wheat lines Table 4 Aberration Chromosome Number Average length of main stem Average length of main spike Average total stooling DvGid1 substitution 1V(1A) 3891/89 89.30 ± 0.66 5.00 ± 0.00 3.33 ± 0.66 Yes substitution 3V(3B) 86/11 68.00 ± 0.00 5.00 ± 0.00 1.00 ± 0.00 - substitution 3V(3D) 1360/07 96.00 ± 0.00 4.00 ± 0.00 1.00 ± 0.00 - substitution 5V(5D) 2333/89 87.66 ± 9.60 7.50 ± 0.29 3.00 ± 0.58 - substitution 6V(6A) 1415/94 88.33 ± 8.95 5.00 ± 0.58 2.67 ± 0.33 - substitution 7V(7A) 3889/89 91.00 ± 5.00 5.00 ± 0.00 2.50 ± 0.50 - substitution 6V#2 [6A CS] 6661 63.30 ± 7.84 6.50 ± 1.26 1.67 ± 0.66 - translocation T4DS·4V#3L 5594 78.00 ± 7.00 6.00 ± 0.58 4.00 ± 1.33 - translocation T4DL·4V#3S 5595 113.00 ± 1.00 8.00 ± 1.00 3.50 ± 0.50 - translocation T1DS·1V#3L 5615 103.00 ± 0.00 6.00 ± 1.00 4.00 ± 1.00 Yes translocation T1DL·1V#3S 5616 84.66 ± 4.51 5.00 ± 0.29 3.33 ± 0.88 - translocation T2BS·2V#3L 5634 64.00 ± 2.00 6.33 ± 0.33 2.67 ± 0.88 - translocation T3DL·3V#3S 5636 97.66 ± 6.36 5.50 ± 0.28 3.00 ± 0.58 - translocation T3DS·3V#3L 5637 76.00 ± 5.30 3.50 ± 0.76 1.33 ± 0.33 - translocation T5DL·5V#3S 5638 94.00 ± 4.50 6.00 ± 0.57 3.00 ± 0.58 - translocation T7DL·7V#3S 5639 56.00 ± 7.00 4.50 ± 0.50 1.00 ± 0.00 - translocation T7DS·7V#3L 5640 67.00 ± 0.00 7.00 ± 0.00 1.00 ± 0.00 - translocation 6BS.6VL 1438/94 86.33 ± 3.66 5.83 ± 0.60 2.00 ± 0.00 - translocation 6AS.6VL 3214/96 95.00 ± 3.51 5.00 ± 0.00 1.67 ± 0.66 - translocation 3V.3BL+3B 853/11 91.50 ± 1.50 7.00 ± 1.00 3.50 ± 0.50 - Since the DvGid1 gene was mapped on the long arm of chromosome 1V, special attention should be paid to comparing the accessions 5615 (T1DS•1V#3L) and 5616 (T1DL•1V#3S). Both accessions provided by Dr. W. Jon Raupp (Center KSU) carry the same translocated chromosome from D. villosum genome of Sicilian origin. However, the first accession has the T1DS•1V#3L translocation in the karyotype, i.e. long arm of the first chromosome carrying the studied gene, and the second - T1DL•1V#3S, i. e. short arm of the same chromosome, but without this gene. Otherwise, these accessions are as genetically similar as possible. But at the phenotype level, certain differences were observed. In the presence of the DvGid1 gene, plant height reached 103 cm, which was almost the maximum height among the studied lines. The exception was the accession 5595 (T4DL•4V#3S), the plants of which were even higher. But it should be considered that the genes encoding DELLA proteins, which interact with the Gid1 proteins and have a significant effect on height, are located in the fourth homeologic group. In the absence of the DvGid1-5616 gene (T1DL•1V#3S), plant height was at the average level (83 cm) of the rest lines with different introgressions of D. villosum (Table 4). The data obtained are consistent with the mechanism of the GID1 protein action and indirectly show us the presence of this protein in substitution/translocation lines, while no signifi ant differences were noted in the genome of the addition lines. Of one of wheat chromosomes is likely to promote the involvement of the alien genes in the processes of protein synthesis followed by subsequent infl of these proteins on plant growth and development. It appears from this study, that substitution and translocation lines in general are more preferable for studying the infl of the individual alien genes, compared with lines bearing the balanced genome and added chromosomes of distant varieties, at least when it comes to initially multichromosomal allopolyploid crops, with large genomes such as common wheat. Conclusions As a result of the study, unique nucleotide sequences of the Gid1 gene of two D. villosum accessions of different origin were first obtained. Comparison with homologous genes of common wheat allowed us to develop a genome-specific marker, Dv-Gid-1F/R, which effectively distinguished the DvGid1 Dasypyrum gene in a wheat background. Localization of the DvGid1 gene on the long arm of chromosome 1V was shown. A preliminary assessment of the phenotypic expression of this gene in a wheat genome background was carried out and a significant effect of the studied gene on plant height was revealed. It was shown that lines carrying a substitution or translocation in the genome were more preferable for such studies, compared with monosomic addition lines.

About the authors

Olga Vladimirovna Razumova

All-Russia Research Institute of Agricultural Biotechnology; Moscow Botanical Garden of Academy of Sciences

Author for correspondence.
Email: razumovao@gmail.com
Moscow, Russian Federation

Candidate of Biological Sciences, Senior Researcher, Laboratory of Applied Genomics and Private Breeding of Agricultural Plants

Mikhail Sergeevich Bazhenov

All-Russia Research Institute of Agricultural Biotechnology

Email: mikhabazhenov@gmail.com
Moscow, Russian Federation

Candidate of Biological Sciences, senior researcher, Laboratory of Applied Genomics and Private Breeding of Agricultural Plants

Ekaterina Aleksandrovna Nikitina

All-Russia Research Institute of Agricultural Biotechnology

Email: shhket@gmail.com
Moscow, Russian Federation

Laboratory Assistant, Laboratory of Applied Genomics and Private Breeding of Agricultural Plants

Lyubov Andreevna Nazarova

All-Russia Research Institute of Agricultural Biotechnology

Email: lpukhova@yandex.ru
Moscow, Russian Federation

Junior Researcher, Laboratory of Applied Genomics and Private Breeding of Agricultural Plants

Dmitry Viktorovich Romanov

All-Russia Research Institute of Agricultural Biotechnology

Email: akabos1987@gmail.com
Moscow, Russian Federation

Candidate of Biological Sciences, senior researcher, Laboratory of Applied Genomics and Private Breeding of Agricultural Plants

Anastasiya Gennadievna Chernook

All-Russia Research Institute of Agricultural Biotechnology

Email: Irbis-sibrI@yandex.ru
Moscow, Russian Federation

Junior Researcher, Laboratory of Applied Genomics and Private Breeding of Agricultural Plants

Pavel Andreevich Sokolov

Russian State Agrarian University - Moscow Timiryazev Agricultural Academy

Email: pav2395147@yandex.ru
Moscow, Russian Federation

Laboratory Assistant Researcher, Center for Molecular Biotechnology

Viktoria Maksimovna Kuznetsova

All-Russia Research Institute of Agricultural Biotechnology

Email: vika-kuz367@yandex.ru
Moscow, Russian Federation

Junior Researcher, Laboratory of Applied Genomics and Private Breeding of Agricultural Plants

Oleg Grigorievich Semenov

Рeoples’ Friendship University of Russia (RUDN University)

Email: semenov_og@rudn.university
Moscow, Russian Federation

Candidate of Biological Sciences, professor, Technosphere Safety Department, Agrarian-technological Institute

Gennady Ilyich Karlov

All-Russia Research Institute of Agricultural Biotechnology; Russian State Agrarian University - Moscow Timiryazev Agricultural Academy

Email: karlovg@gmail.com
Moscow, Russian Federation

Doctor of Biological Sciences, Professor, Academician of the Russian Academy of Sciences, Director

Petr Nikolaevich Kharchenko

All-Russia Research Institute of Agricultural Biotechnology

Email: iab@iab.ru
Moscow, Russian Federation

Doctor of Biological Sciences, Professor, Academician of the Russian Academy of Sciences, Scientific Advisor

Mikhail Georgievich Divashuk

All-Russia Research Institute of Agricultural Biotechnology; Russian State Agrarian University - Moscow Timiryazev Agricultural Academy

Email: divashuk@gmail.com
Moscow, Russian Federation

Candidate of Biological Sciences, leading researcher, Laboratory of Applied Genomics and Private Breeding of Agricultural Plants

References

  1. Ray DK, Mueller ND, West PC, Foley JA.Yield trends are insufficient to double global crop production by 2050. PloS one. 2013; 8(6): e66428. doi: 10.1371/journal.pone.0066428
  2. Minelli S, Ceccarelli M, Mariani M, De Pace C, Cionini PG. Cytogenetics of Triticum× Dasypyrum hybrids and derived lines. Cytogenetic and genome research. 2005; 109(1-3):385-392. doi: 10.1159/000082424
  3. Li H, Dong Z, Ma C, Tian X, Qi Z, Wu N, et al. Physical Mapping of Stem Rust Resistance Gene Sr52 from Dasypyrum villosum Based on ph1b-Induced Homoeologous Recombination. International Journal of Molecular Sciences. 2019; 20(19):4887. doi: 10.3390/ijms20194887
  4. Djanaguiraman M, Prasad PV, Kumari J, Sehgal SK, Friebe B, Djalovic I, et al. Alien chromosome segment from Aegilops speltoides and Dasypyrum villosum increases drought tolerance in wheat via profuse and deep root system. BMC plant biology. 2019; 19(1):242. doi: 10.1186/s12870-019-1833-8
  5. Zhang R, Fan Y, Kong L, Wang Z, Wu J, Xing L, et al. Pm62, an adult-plant powdery mildew resistance gene introgressed from Dasypyrum villosum chromosome arm 2VL into wheat. Theoretical and Applied Genetics. 2018; 131(12):2613-2620. doi: 10.1007/s00122-018-3176-5
  6. Li G, Gao D, Zhang H, Li J, Wang H, La S, et al. Molecular cytogenetic characterization of Dasypyrum breviaristatum chromosomes in wheat background revealing the genomic divergence between Dasypyrum species. Molecular Cytogenetics. 2016; 9(1):6. doi: 10.1186/s13039-016-0217-0
  7. Zhang H, Li G, Li D, Gao D, Zhang J, Yang E, et al. Molecular and cytogenetic characterization of new wheat - Dasypyrum breviaristatum derivatives with post-harvest re-growth habit. Genes. 2015;6(4):1242-1255. doi: 10.3390/genes6041242
  8. Blanco A, Simeone R, Resta P. The addition of Dasypyrum villosum (L.) Candargy chromosomes to durum wheat (Triticum durum Desf.). Theoretical and applied genetics. 1987; 74(3):328-333. doi: 10.1007/ BF00274714
  9. Friebe B, Cermeno MC, Zeller FJ. C-banding polymorphism and the analysis of nucleolar activity in Dasypyrum villosum (L.) Candargy, its added chromosomes to hexaploid wheat and the amphiploid Triticum dicoccum - D. villosum. Theoretical and applied genetics. 1987; 73(3):337-342. doi: 10.1007/BF00262498
  10. Liu C, Qi L, Liu W, Zhao W, Wilson J, Friebe B, et al. Development of a set of compensating Triticum aestivum-Dasypyrum villosum Robertsonian translocation lines. Genome. 2011; 54(10):836-844. doi: 10.1139/ g11-051
  11. Zhang R, Hou F, Feng Y, Zhang W, Zhang M, Chen P., et al. Characterization of a Triticum aestivum - Dasypyrum villosum T2VS2DL translocation line expressing a longer spike and more kernels traits. Theoretical and applied genetics. 2015; 128(12):2415-2425. doi: 10.1007/s00122-015-2596-8
  12. De Pace C, Snidaro D, Ciaffi M, Vittori D, Ciofo A, Cenci A, et al. Introgression of Dasypyrum villosum chromatin into common wheat improves grain protein quality. Euphytica. 2001; 117(1):67-75. doi: 10.1023/A:1004095705460
  13. Okuno A, Hirano K, Asano K, Takase W, Masuda R, Morinaka Y, et al. New approach to increasing rice lodging resistance and biomass yield through the use of high gibberellin producing varieties. PLoS One. 2014; 9(2): e86870. doi: 10.1371/journal.pone.0086870
  14. Wu Y, Wang Y, Mi XF, Shan JX, Li XM, Xu JL, et al. The QTL GNP1 encodes GA20ox1, which increases grain number and yield by increasing cytokinin activity in rice panicle meristems. PLoS genetics. 2016; 12(10): e1006386. doi: 10.1371/journal.pgen.1006386
  15. Hedden P. The genes of the Green Revolution. TRENDS in Genetics. 2003; 19(1):5-9. doi: 10.1016/ S0168-9525(02)00009-4
  16. Peng J, Richards DE, Hartley NM, Murphy GP, Devos KM, Flintham JE, et al. ‘Green revolution’ genes encode mutant gibberellin response modulators. Nature. 1999; 400(6741):256-261. doi: 10.1038/22307
  17. Gallego-Giraldo C, Hu J, Urbez C, Gomez MD, Sun TP, et al. Role of the gibberellin receptors GID1 during fruit-set in Arabidopsis. The Plant Journal. 2014; 79(6):1020-1032. doi: 10.1111/tpj.12603
  18. Harberd NP, Belfield E, Yasumura Y. The angiosperm gibberellin-GID1-DELLA growth regulatory mechanism: how an “inhibitor of an inhibitor” enables flexible response to fluctuating environments. The Plant Cell. 2009; 21(5):1328-1339. doi: 10.1105/tpc.109.066969
  19. Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic acids research. 1980; 8(19):4321-4326. doi: 10.1093/nar/8.19.4321
  20. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. Journal of computational biology. 2012; 19(5):455-477. doi: 10.1089/cmb.2012.0021
  21. Zaharia M, Bolosky WJ, Curtis K, Fox A, Patterson D, Shenker S, et al. Faster and more accurate sequence alignment with SNAP. 2011. Available from: http://www.icsi.berkeley.edu/pubs/networking/ICSI_ fasterandmoreaccurate11.pdf
  22. Nicholas KB, Nicholas HB. Genedoc: a tool for editing and annotating multiple sequence alignments. 1997. Available from: www.nrbsc.org/gfx/genedoc/index.html
  23. Zhang R, Sun B, Chen J, Cao A, Xing L, Feng Y, et al. Pm55, a developmental-stage and tissue-specific powdery mildew resistance gene introgressed from Dasypyrum villosum into common wheat. Theoretical and Applied Genetics. 2016; 129(10):1975-1984. doi: 10.1007/s00122-016-2753-8
  24. Sokolov PA, Krupin PY, Divashuk MG, Karlov GI. Using PLUG-markers to analyze the collection of soft wheat lines disomically complemented with Dasypyrum villosum chromosomes. Izvestiya of Timiryazev agricultural academy. 2017; (4):147–157. (In Russ).

Statistics

Views

Abstract - 486

PDF (Mlt) - 89

Cited-By


PlumX

Dimensions


Copyright (c) 2020 Razumova O.V., Bazhenov M.S., Nikitina E.A., Nazarova L.A., Romanov D.V., Chernook A.G., Sokolov P.A., Kuznetsova V.M., Semenov O.G., Karlov G.I., Kharchenko P.N., Divashuk M.G.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies