Identification of genes for resistance to leaf and stem rust in breeding lines of spring common wheat from the secondary gene pool of Arsenal collection

Cover Page

Cite item

Abstract

Leaf rust (Puccinia triticina Eriks.) and stem rust (Puccinia graminis f. sp. tritici) are the main causes of declining wheat yields in Russia and abroad. Epidemics of these diseases lead to significant economic losses. In recent years, there has been increased pressure from new, more aggressive races of pathogens. As a result, a breeding strategy aimed at protecting wheat varieties from these diseases is extremely relevant and a priority. The aim of this work was to identify effective and partially effective genes of resistance to leaf (Lr19, Lr24, Lr26, Lr29, Lr34, Lr37) and stem (Sr17, Sr22, Sr36, Sr39, Sr47) rust in the Ob forest-­steppe of the Altai Territory for the further development of a set of breeding measures aimed at creating new varieties of spring wheat with resistance to rust diseases in local conditions using modern methods of molecular marker selection. The material for the study was 25 promising lines of spring common wheat of secondary origin from Arsenal collection (Nemchinovka Research Center) with group resistance to leaf-stem diseases and having genetic material of the species Aegilops speltoides, Ae. triuncialis, Triticum kiharae, Secale cereale and T. migushovae in the pedigree. Molecular analysis made it possible to determine effective Lr genes in 80 %, and Sr genes in all tested accessions. The largest number of identified genes (5–6) were found in the following lines: 5–16i, 20–16i, 34–16i, 44–16i, 45–16i, 48–16i, 53–16i, and the smallest (2–3) in: 1–16i, 14–16i, 19–16i, 21–16i, 25–16i, 40–16i, 49–16i, 61–16i and 135/10i. The desired Lr genes were not found in accessions 1–16i, 28–16i, 49–16i, 61–16i. The results of the studies showed the presence of a wide range of genes of resistance to leaf and stem rust, which indicates the donor properties of the lines of Arsenal collection and the possibility of their effective use in marker associated selection in the development of wheat varieties resistant to rust diseases.

Full Text

Introduction

Leaf rust (Puccinia triticina Eriks.) and stem rust (Puccinia graminis f. sp. tritici) are regularly occurring and dangerous wheat diseases both in Russia and abroad. As part of programs to ensure the overall quality of wheat, advanced breeding lines and various wheat varieties are being tested for resistance to common rust species.

To slow the growth of pathogens that affect grain crops and prevent the emergence of new, more dangerous races, it is necessary to employ strategies aimed at increasing the genetic stability of the agrocenosis. These include a partial mixture of varieties and the cultivation of varieties with different levels of resistance to survival within a single area (variety mosaic strategy). In advanced countries, the differences are 3–4 years, while in Russia this period is significantly longer — 7–10 years or more [1]. Breeding efforts aimed at developing spring wheat varieties demonstrate a diverse genetic basis for resistance to leaf and stem diseases, which is highly relevant.

More than 80 genes of resistance to leaf and stem rust with established localization on wheat chromosomes are known [2]. West Siberian populations of leaf and stem rust are distinguished by particular virulence and can overcome plant resistance genes that are effective in other regions. Genes of juvenile resistance (Lr24, Lr28, Lr41, Lr45, Lr47, LrAg, LrAeg.speltoides) and age-related resistance (Lr35, Lr48, Lr49) have been identified that are highly effective against Puccinia triticina [3]. In conditions of the southern forest-­steppe of Western Siberia, spring wheat lines with the following genes showed immunity to stem rust: Sr9e, Sr24, Sr25, Sr26, Sr27, Sr31, Sr33, Sr35, Sr36, Sr38, SRDP‑2 with the Sr7a+Sr12+Sr gene pyramid [4]. According to the results of our own evaluations of the collection of near-isogenic lines with the Lr and Sr genes in 2022, the following genes showed high efficiency: Lr9, Lr19, Lr24, Lr25, Lr26, Lr28, Lr29, Lr35, Lr37, Lr44, Lr45, Lr47 and Sr24, Sr31, Sr36.

The aim of this study was to identify several known effective and partially effective genes for resistance to leaf (Lr19, Lr24, Lr26, Lr29, Lr34, Lr37) and stem (Sr17, Sr22, Sr36, Sr39, Sr47) rust in spring common wheat lines from the secondary gene pool of the Arsenal collection using modern diagnostic methods. The obtained results will serve as the basis for developing a set of measures aimed at creating new spring wheat varieties with resistance to leaf and stem rust in the conditions of the Ob forest-­steppe of Altai Krai using the MAS method.

Materials and methods

The research was conducted in 2024–2025 at the molecular genetics laboratory of Altai Research Institute of Agriculture. To identify the Lr and Sr genes, 25 spring common wheat lines from the secondary gene pool of Arsenal collection, developed at Nemchinovka Research Center through multi-­stage hybridization of donors of resistance to the Ug99 race of stem rust, were used. These breeding lines possess group resistance to European and West Siberian populations of leaf and stem rust [5], which was confirmed by field studies in the experimental field of Altai Research Institute of Agriculture in 2021–2022. The CIMMYT scale [6] was used to assess the response and degree of damage by rust species.

Wheat DNA was isolated from 6–7‑day-old etiolated seedlings using the method of Plaschke et al. [7]. Gene identification was performed using the polymerase chain reaction (PCR) method with primers marking the Lr genes: Lr19, Lr24, Lr26, Lr29, Lr34, Lr37 and the Sr genes: Sr17, Sr22, Sr36, Sr39, Sr47. Primers were selected based on literature data; their nucleotide sequences are shown in Table 1.

Table 1
PCR-markers used to identify Lr and Sr-genes

 Gene

 Markers

 Source

 Marker ID

 Primer sequences (5′-3′)

 Product size, bp

 Lr19

 SCS265-FSCS265-R

 GGCGGATAAGCAGAGCAGAGGGCGGATAAGTGGGTTATGG

 512

 [8]

 Lr24

 SCS73-FSCS73-R

 TCGTCCAGATCAGAATGTGCTCGTCGATTAGCAGTGAG

 719

 [9]

 Lr26

 SCM9-FSCM9-R

 TGACAACCCCCTTTCCCTCGTTCATCGACGCTAAGGAGGACCC

 207

 [10]

 Lr29

 Lr29F24Lr29R24

 GTGACCTCAGGCAATGCACACAGTGTGACCTCAGAACCGATGTCCATC

 900

 [11]

 Lr34

 csLV34-FcsLV34-R

 GTTGGTTAAGACTGGTGATGGTGCTTGCTATTGCTGAATAGT

 150

 [12]

 Lr37

 VentriupLN2

 AGGGGCTACTGACCAAGGCTTGCAGCTACAGCAGTATGTACACAAAA

 259

 [13]

 Sr17

 WPT5343-FWPT5343-R

 TATTCTACAACGCTCCATCCCGCATGCAANCCATACCTTT

 407

 [14]

 Sr22

 WMC633-FWMC633-R

 ACACCAGCGGGGATATTTGTTACGTGCACAAGACATGAGGTGGATT

 117

 [15]

 Sr36

 XSTM773–2FXSTM773–2R

 ATGGTTTGTTGTGTTGTGTGTAGGAAACGCCCCAACCACCTCTCTC

 155

 [16]

 Sr39

 SR39#22-FSR39#22-R

 AGAGAAGATAAGCAGTAAACATGTGCTGTCATGAGAGGAACTCTG

 487

 [17]

 Sr39#50s-­FSr39#50s-­R

 CCAATGAGGAGATCAAAACAACCCTAGCAAGGACCAAGCAATCTTG

 167

 Sr47

 WGWM501-FWGWM501-R

 GGCTATCTCTGGCGCTAAAATCCACAAACAAGTAGCGCC

 109

 [18]

Source: compiled by V.A. Petin.

Results and Discussion

Based on our evaluation of the breeding lines, the entire collection demonstrated high resistance to leaf and stem rust in the Ob forest-­steppe conditions of the Altai Krai in 2021 and 2022, compared to the standard variety, Altayskaya 70, which was 60–70% susceptible to leaf rust and 40% susceptible to stem rust (Table 2). Based on this, it was concluded that these lines possess effective resistance genes, Lr and Sr, or combinations thereof.

Table 2
Results of the evaluation of resistance of lines from Arsenal collection to leaf and stem rust, experimental field of Altai Research Institute of Agriculture, 2021–2022

 Variety/Line

 Pedigree*

 Evaluation of resistance to leaf rust, %/type

 Evaluation of resistance
to stem rust, %/type

 2021

 2022

 2021

 2022

 Altaiskaya‑70 (susceptible standart)

 Altaiskaya‑98/Altaiskaya‑325

 70S

 60S

 40S

 40S

 1–16i

 (96/113)/145//113

 10MR

 5MR

 5MR

 5MR

 5–16i

 (96/113)/145

 5MR

 R

 5MR

 5MR

 6–16i

 (96/113)/145

 R

 R

 0

 0

 14–16i

 96/113

 R

 R

 R

 R

 17–16i

 96/113

 R

 R

 0

 0

 19–16i

 96/113

 0

 0

 R

 R

 20–16i

 96/113

 R

 R

 R

 0

 21–16i

 96/113

 0

 R

 0

 R

 25–16i

 96/113

 0

 R

 R

 R

 28–16i

 (113/96)/145//113

 R

 R

 R

 0

 30–16i

 (113/96)/113

 R

 R

 0

 0

 31–16i

 (113/96)/113

 R

 R

 R

 R

 34–16i

 (113/96)/113

 5MR

 5MR

 0

 0

 36–16i

 (113/96)/145

 R

 R

 R

 R

 37–16i

 (113/96)/145

 R

 5MR

 R

 0

 40–16i

 (113/96)/145

 R

 R

 5MR

 5MR

 44–16i

 (113/119)/113

 0

 0

 0

 0

 45–16i

 (113/119)/113

 0

 0

 R

 0

 48–16i

 (113/119)/113

 0

 R

 0

 0

 49–16i

 (113/119)/113

 R

 5MR

 5MR

 5MR

 53–16i

 (113/119)/113

 5MR

 R

 5MR

 5MR

 57–16i

 (113/119)/119

 R

 R

 0

 0

 60–16i

 (119/113)/113/113

 0

 R

 5MR

 5MR

 61–16i

 (119/96)/113

 R

 R

 0

 0

 135/10i

 102/00i /Estivum 440

 R

 R

 0

 0

Note. *The following donors of resistance to leaf and stem rust participated in the creation of the lines: GT 96/90 winter wheat line (Bulgaria) with T. migushovae genetic material (in the table it is listed as line 96); Line 113/00i‑4 is a sample of spring wheat from the Arsenal collection with genetic material of the species Ae. triuncialis and T. kiharae (in the table — line 113); The spring wheat line 145/05i is the result of crossing the Lada spring variety with a sample from the Arsenal collection k‑62903, which was obtained with the participation of the Ae. speltoides species (in the table — line 145); The winter wheat line 119/4–06rw is a three-­genera wheat-­aegilops-rye hybrid containing foreign material Ae. speltoides and S. cereale (in the table — line 119). The spring wheat line 135/10i is the result of crossing a sample from the Arsenal collection 102/00i (with genetic material Ae. speltoides) with Estivum 440 spring wheat [Chaika(w)/Tselinnaya 20/3/ Yubileynaya Osetii (w)//Bezostaya 1/Saratovskaya 36].

Source: compiled by V.A. Petin.

In wheat breeding, the genetic diversity of wild and cultivated relatives, as well as other cereal crops, is widely used to improve resistance to pathogens. The 1RS/1BL translocation, carrying the Lr26, Sr31, Yr9, and Pm8 genes, which provide resistance to powdery mildew and rust diseases, is one of the most frequently used genetic elements in breeding programs worldwide [19]. Although the Sec‑1 locus, encoding ε-secalin (secalins are storage proteins in rye grain), has a negative effect on the baking qualities of wheat, the 1RS/1BL translocation generally has a positive effect on yield and adaptability to environmental conditions [20].

Identification of the Lr26 gene was carried out using the SCM9 marker, which allows differentiation of genotypes carrying 1BL.1RS and 1AL.1RS translocations. An amplicon of 207 bp indicates the presence of the 1BL.1RS translocation, and 228 bp indicates the 1AL.1RS translocation [21]. As a result of PCR, an amplification fragment of only 207 bp in size was detected in 16 lines: 5-16i, 53-16i, 6-16i, 14-16i, 17-16i, 19-16i, 20-16i, 21-16i, 25-16i, 30-16i, 31-16i, 36-16i, 37-16i, 44-16i, 45-16i, 48-16i. Common wheat received the translocation 1RS from the rye variety Petkus, which is located in the long arm of chromosome 1B. This translocation also contains genes for resistance to powdery mildew Pm8, stem (Sr31) and yellow (Yr9) rust [2]. Genes for resistance to three types of rust are independent but closely linked to each other. The 1BL.1RS translocation, among other things, contains genes that favorably influence yield, grain quality, and drought tolerance, which is achieved through increased root mass [20].

The Lr34 gene confers slow-rusting resistance to wheat plants, which is characterized by an extended period of disease development after infection, as well as a reduction in the number and size of pathogen pustules on the leaf surface. Using this gene in combination with other leaf rust resistance genes (Lr10, Lr13, Lr16, etc.) will allow the development of less susceptible wheat samples and varieties [22].

The Lr34 leaf rust resistance gene is considered to be of low efficacy in Russia [23], but it is valuable as a source of other disease resistance genes linked to it in the same chromosome segment, such as yellow rust (Yr18), powdery mildew (Pm46), and stem rust (Sr57) [5]. Identification of the Lr34 gene was performed using the codominant STS marker csLV34, which identifies the gene in various allelic states. The dominant (functional) allele is indicated by the presence of amplification fragment with a molecular weight of 150 bp in the samples, while the recessive (non-functional) allele is indicated by 229 bp fragment. The detection of both allelic variants of the Lr34 gene in a sample may indicate heterozygosity at this locus, or it may be a consequence of heterogeneity in the source material due to DNA extraction from several seedlings with different genotypes.

Almost all of the presented lines possessed the recessive allele of the Lr34 gene. The dominant allele was detected only in lines 34–16i, 40–16i, and 135/10, while the heterozygous allelic state was observed only in the control sample.

The Lr37 gene was transferred to common wheat via the 2NS‑2AS translocation from Aegilops ventricosa as part of the Yr17/Lr37/Sr38 gene cluster and is localized on the short arm of chromosome 2A. Until recently, it was considered highly effective in many countries. However, the widespread cultivation of varieties with Lr37 gene in Western Europe has led to a loss of its effectiveness. In Russia, the effectiveness of Lr37 gene varies by region from high to moderate [24].

Identification of the Lr37 gene in collection lines was performed using the VENTRIUP and LN2 primers. A 259 bp marker fragment was detected in 11 genotypes: 5-16i, 34-16i, 53-16i, 60-16i, 17-16i, 30-16i, 31-16i, 44-16i, 45-16i, 48-16i, and 57-16i.

The Lr19, Lr24, and Lr29 genes were introgressed into wheat from Agropyrum elongatum. All of them are located in the D genome and are closely linked to the stem rust resistance genes Lr19/Sr25 and Lr24/Sr24. These genes are considered highly effective and are widely used in breeding. To identify these genes, the SCAR markers SCS265 (Lr19), SCS73 (Lr24), and Lr29F24 (Lr29) were used. Amplification fragments for all three genes were detected only in control samples, indicating the absence of Agropyrum elongatum genetic material in the pedigrees of the studied lines.

The Sr17 gene (from T. turgidum), located on chromosome 7B and linked to Lr14a/Pm5, although ineffective against Ug99, can provide resistance to local populations in certain regions and in combination with other genes, such as Sr13 [25]. The Sr17 gene was detected using the DArT marker wPt 5343 in four lines: 20-16i, 34-16i, 44-16i, and 53-16i.

The Sr22 gene was originally identified in Triticum monococcum and was then transferred to tetraploid and hexaploid wheat through interspecific hybridization. This gene is effective against all races of stem rust, and there are lines with Sr22 that are not linked to undesirable agronomic traits [26].

Sr22 was previously mapped to the long arm of chromosome 7A. Three linked markers, CFA2019, CFA2123, and BARC121, were used to haplotype this locus [27]. Olson et al. [15] generated a new set of lines with reduced foreign fragments and found that the closest markers adjacent to Sr22 in these lines were WMC633 and CFA2123.

When using marker CFA2123, a characteristic 234 bp product was found. We observed this in all the samples studied, including the negative control. Since this marker is not fully diagnostic and can give false-­positive results, we used another SSR marker, WMC633. As a result, we detected amplified products that were described as not only diagnostic. All lines had fragments of approximately 240 bp, and 117 bp were absent only in 21–16i, 40–16i, 34–16i, and 17–16i. As Olson et al. [15] wrote, this may be due to recombination between the resistance gene and all markers mapped in this region.

Sr36 was introgressed into wheat from T. timopheevii and is localized on the short arm of chromosome 2B. This gene is widely used in breeding and is distributed in many varieties worldwide. Sr36 is effective against most stem rust races, including Ug99, except for the TTKST and TTTSK varieties [28]. It is also used to create pyramids in combination with other Sr genes during the breeding of resistant wheat varieties.

To detect this gene, the SSR codominant marker Xstm 773–2 was used, yielding clear, readable fragments of 155 bp in length, indicating the presence of the gene, and 190 bp in length, indicating the absence of the gene. The 155 bp fragment was amplified in most accessions, while the 190 bp fragment was detected in 25–16i and 135/10i.

The stem rust resistance gene Sr39 confers resistance to all known pathotypes of Puccinia graminis f. sp. tritici, including Ug99 (TTKSK) and its variants, TTKST and TTTSK, which are virulent against Sr24 and Sr36, two frequently used resistance genes. The Sr39 gene was transferred into the hexaploid wheat cultivar Marquis to chromosome 2B from the 2S chromosome of Aegilops speltoides [29]. The transferred segment also contains the leaf rust resistance gene Lr35. To identify Sr39, the markers Sr39#22r and Sr39#50s were used. The first marker revealed a fragment of 820 bp in all samples, which did not correspond to the diagnostic fragment of 487 bp. A similar situation was observed for the second marker: with a declared fragment of 167 bp, products of 240 and 280 bp were amplified in the samples. At this stage of research, we can assume that the chromosomal region containing the annealing site of these primers is missing. Later, when we obtain a control line with the Sr39 gene, repeat PCR analysis will allow us to confirm this assumption.

The stem rust resistance gene Sr47 was transferred from Aegilops speltoides by homeologous recombination using the ph1b mutant into durum wheat, resulting in the DAS15 line. We tested for the presence of the Sr47 gene, but without a control, as was the case with Sr39. A pronounced 109‑bp product was observed in most accessions, except for accessions 14-16i, 19-16i, 25-16i, 31-16i, and 44-16i, which did not contain it. The researchers note that when using Xgwm501, a saturated fragment of 109 bp in length indicates the presence of Ae. speltoides chromatin, while the absence of the fragment or its lesser expression may indicate a segment of the wheat chromosome [30].

As a result of molecular screening, both single Lr and Sr genes and their pyramid were detected in the studied spring common wheat lines (Table 3). The greatest number of identified genes was found in line 53-16i (Lr26, Lr37, Sr17, Sr22, Sr36, Sr47), while in lines 1-16i, 28-16i, 49-16i, 61-16i the studied Lr genes were not detected. Considering the high resistance of the latter genotypes in the conditions of the Altai Territory and the southern forest-­steppe of Western Siberia, there is a high probability of the presence of other effective resistance genes (e. g. Lr35, Sr32, Sr39, Sr40) or new resistance genes transferred from Ae. speltoides, T. kiharae or T. migushovae.

Table 3
Identification of Lr and Sr genes in spring common wheat lines from Arsenal collection

 Variety/Line

 Lr–genes

 Sr–genes

 Lr26

 Lr34

 Lr37

 Sr17

 Sr22

 Sr36

 Sr47

 Altaiskaya‑70

 –

 –

 –

 –

 –

 –

 –

 1–16i

 –

 –

 –

 –

 +

 +

 +

 5–16i

 +

 –

 +

 –

 +

 +

 +

 6–16i

 +

 –

 –

 –

 +

 +

 +

 14–16i

 +

 –

 –

 –

 +

 +

 –

 17–16i

 +

 –

 +

 –

 –

 +

 +

 19–16i

 +

 –

 –

 –

 +

 +

 –

 20–16i

 +

 –

 –

 +

 +

 +

 +

 21–16i

 +

 –

 –

 –

 –

 +

 +

 25–16i

 +

 –

 –

 –

 +

 –

 –

 28–16i

 –

 –

 –

 –

 +

 +

 +

 30–16i

 +

 –

 +

 –

 +

 +

 +

 31–16i

 +

 –

 +

 –

 +

 +

 –

 34–16i

 –

 +

 +

 +

 –

 +

 +

 36–16i

 +

 –

 –

 –

 +

 +

 +

 37–16i

 +

 –

 –

 –

 +

 +

 +

 40–16i

 –

 +

 –

 –

 –

 +

 +

 44–16i

 +

 –

 +

 +

 +

 +

 –

 45–16i

 +

 –

 +

 –

 +

 +

 +

 48–16i

 +

 –

 +

 –

 +

 +

 +

 49–16i

 –

 –

 –

 –

 +

 +

 +

 53–16i

 +

 –

 +

 +

 +

 +

 +

 57–16i

 –

 –

 +

 –

 +

 +

 +

 60–16i

 –

 –

 +

 –

 +

 +

 +

 61–16i

 –

 –

 –

 –

 +

 +

 +

 135/10i

 –

 +

 –

 –

 +

 –

 +

Source: compiled by V.A. Petin.

Conclusion

The presence of a wide range of leaf and stem rust resistance genes in wheat lines from Arsenal collection was identified, indicating the donor properties of these lines and the possibility of their effective use in MAS to overcome the genetic uniformity of local varieties in terms of resistance to rust diseases and address the phytosanitary situation in the region.

×

About the authors

Vadim A. Petin

Altai Research Institute of Agriculture

Author for correspondence.
Email: 999.source.z@mail.ru
ORCID iD: 0000-0001-6175-9510
SPIN-code: 7177-1334

Junior Researcher

35 Nauchniy gorodok, Barnaul, Altai Territory, 656910, Russian Federation

Sergey B. Lepekhov

Altai Research Institute of Agriculture

Email: sergei.lepehov@yandex.ru
ORCID iD: 0000-0003-1561-6345
SPIN-code: 9394-4835

Candidate of Agricultural Sciences, Leading Researcher

35 Nauchniy gorodok, Barnaul, Altai Territory, 656910, Russian Federation

Inna F. Lapochkina

Nemchinovka Research Center

Email: lapochkina@yandex.ru
ORCID iD: 0000-0002-2328-2798
SPIN-code: 9642-0889

Doctor of Biological Sciences, Chief Researcher

30 Bolshoy Bulvar, bldg. 1, Skolkovo, Moscow, 121205, Russian Federation

Nail R. Gainullin

Nemchinovka Research Center

Email: gainullin.nail@gmail.com
ORCID iD: 0000-0002-0970-662X
SPIN-code: 4974-2310

Candidate of Biological Sciences, Leading Researcher

30 Bolshoy Bulvar, bldg. 1, Skolkovo, Moscow, 121205, Russian Federation

References

  1. Sanin SS. Phytosanitary problems of grain production. In: Protection of grain crops from diseases, pests, weeds: achievements and problem: conference proceedings. 2016. p.4–15. (In Russ.). EDN: YQWIIH
  2. McIntosh RA, Yamazaki Y, Devos KM, Dubcovsky J, Rogers JW, Appels R. Catalogue of Gene Symbols for Wheat. In: Proceedings of the 12th international wheat genetics symposium. Tokyo: Yokohama. 2013.
  3. Sochalova LP, Lihenko IE. Assessment of resistance to leaf rust of isogenic Lr-lines and wheat varieties in the Novosibirsk region. Achievements of Science and Technology in Agro-Industrial Complex. 2016;30(3):46–50. (In Russ.). EDN: VUZZSF
  4. Shamanin VP, Morgunov AI, Petuhovskij SL, Lihenko IE, Levshunov MA, Salina EA et. al. Selektsiya yarovoi myagkoi pshenitsy na ustoichivost’ k steblevoi rzhavchine v Zapadnoi Sibiri [Breeding of spring soft wheat for resistance to stem rust in Western Siberia]. Omsk; 2015. (In Russ.).
  5. Lapochkina IF, Baranova OA, Shamanin VP, Volkova GV, Gajnullin NR, Anisimova AV et. al. The development of initial material of spring common wheat for breeding for resistance to stem rust (Puccinia graminis pers. f. sp. tritici), uncluding race Ug99, in Russia. Vavilov Journal of Genetics and Breeding. 2016;20(3):320–328. (In Russ.). doi: 10.18699/VJ16.167 EDN: WLVKEV
  6. Kojshybaev M, Mumindzhanov H. Metodicheskie ukazaniya po monitoringu boleznei, vreditelei i sornykh rastenii na posevakh zernovykh kul’tur [Methodological guidelines for monitoring diseases, pests and weeds in grain crops]. Ankara; 2014. (In Russ.).
  7. Plaschke J, Ganal MW, Roder MS. Deteсtion of genetic diversity in closely related bread wheat using microsatellite markers. Theoretical and Applied Genetics. 1995;91:1001–1007. doi: 10.1007/BF00223912 EDN: OODEIJ
  8. Gupta SK, Charpe A, Prabhu KW, Haque OMR. Identification and validation of molecular markers linked to the leaf rust resistance gene Lr19 in wheat. Theoretical and Applied Genetics. 2006;113(6):1027–1036. doi: 10.1007/s00122–006–0362–7 EDN: LNNCZF
  9. Prabhu KV, Gupta SK, Charpe A, Koul S. SCAR marker tagged to the alien leaf rust resistance gene Lr19 uniquely marking the Agropyron elongatum-­derived gene Lr24 in wheat: a revision. Plant Breeding. 2004;123(5):417–420.
  10. Saal B, Wricke G. Development of simple sequence repeat markers in rye (Secale cereale L.). Genome. 1999;42(5):964–972. doi: 10.1139/g99-052 EDN: XOGPAB
  11. Procunier JD, Townley-­Smith TF, Fox S, Prashar S, Gray M, Kim WK, et al. PCR-based RAPD/DGGE markers linked to leaf rust resistance genes Lr29 and Lr25 in wheat (Triticum aestivum L.). Journal of Genetics and Breeding. 1995;49:87–92.
  12. Lagudah ES, McFadden H, Singh RP, Huerta-­Espino J, Bariana HS, Spielmeyer W. Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theoretical and Applied Genetics. 2006;114:21–30. doi: 10.1007/s00122-006-0406-z EDN: KHWMZS
  13. Helguera M, Khan IA, Kolmer J, Lijavetzky D, Zhong-Qi L, Dubcovsky J. PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop Science. 2003;43(5):1839–1847.
  14. Crossa J, Burgueño J, Dreisigacker S, Vargas M, Herrera-­Foessel SA, Lillemo M, et. al. Association analysis of historical bread wheat germplasm using additive genetic covariance of relatives and population structure. Genetics. 2007;177(3):1889–1913. doi: 10.1534/genetics.107.078659 EDN: YBMSNL
  15. Olson EL, Brown-Guedira G, Marshall D, Stack E, Bowden RL, Jin Y, et. al. Development of lines with a small introgressed segment carrying stem rust resistance gene Sr22. Crop Science. 2010;50(5):1823–1830.
  16. Tsilo TJ, Jin Y, Anderson JA. Diagnostic microsatellite markers for the detection of stem rust resistance gene Sr36 in diverse genetic backgrounds of wheat. Crop Science. 2008;48:253–261.
  17. Mago R, Zhang P, Bariana HS, Verlin DC, Bansal UK, Ellis JG, et. al. Development of wheat lines carrying stem rust resistance gene Sr39 with reduced Aegilops speltoides chromatin and simple PCR markers for marker-­assisted selection. Theoretical and Applied Genetics. 2009;119(8):1441–1450. doi: 10.1007/s00122-009-1146-7 EDN: YTDSNW
  18. Faris JD, Xu SS, Cai X, Friesen TL, Jin Y. Molecular and cytogenetic characterization of a durum wheat — Aegilops speltoides chromosome translocation conferring resistance to stem rust. Chromosome Research. 2008;16(8):1097–1105. doi: 10.1007/s10577-008-1261-3 EDN: THOAFH
  19. Mago R, Miah H, Lawrence GJ, Wellings CR, Spielmeyer W, Bariana HS, et. al. High-resolution mapping and mutation analysis separate the rust resistance genes Sr31, Lr26 and Yr9 on the short arm of rye chromosome 1. Theoretical and applied genetics. 2005;112:41–50. doi: 10.1007/s00122-005-0098-9 EDN: XOWBPJ
  20. Kim W, Johnson JW, Baenziger PS, Lukaszewski AJ, Gaines CS. Agronomic effect of wheat-rye translocation carrying rye chromatin (1R) from different sources. Crop Science. 2004;44(4):1254–1258.
  21. Weng Y, Azhaguvel P, Devkota RN, Rudd JC. PCR-based markers for detection of different sources of 1AL.1RS and 1BL.1RS wheat-rye translocations in wheat background. Plant Breeding. 2007;126(5):482–486. doi: 10.1111/j.1439-0523.2007.01331.x EDN: XPMTWX
  22. Schnurbusch T, Bossolini E, Messmer B, Keller B. Tagging and validation of a major quantitative trait locus for leaf rust resistance and leaf tip necrosis in winter wheat cultivar Forno. Phytopathology. 2004;94(10):1036–1041.
  23. Gultyaeva EI, Sadovaya AS. Breeding of common wheat for resistance to brown rust of wheat in Russia. Plant Protection and Quarantine. 2014;(10):24–26. (In Russ.). EDN: SNGPTX
  24. Gultyaeva EI. Geneticheskaya struktura populyatsii Puccinia triticina v Rossii i ee izmenchivost’ pod vliyaniem rasteniya-­khozyaina [The genetic structure of Puccinia triticina populations in Russia and its variability under the influence of the host plant]. Saint Petersburg; 2018. (In Russ.). EDN: URARXH
  25. Baranova OA, Lapochkina IF, Anisimova AV, Gainullin NR, Jordanskaya IV, Makarova IY. Identification of Sr genes in new common wheat sources of resistance to stem rust race Ug99 using molecular markers. Vavilov Journal of Genetics and Breeding. 2015;19(3):316–322. (In Russ.). doi: 10.18699/VJ15.041 EDN: UFFNSX
  26. Shiferaw GA, Hoffmann B. Recent advances and future perspectives in resistance breeding against Puccinia graminis f. sp. tritici, strain Ug99. Acta Agronomica Hungarica. 2012;60(1):71–86.
  27. Yu LX, Liu S, Anderson JA, Singh RP, Jin Y, Dubcovsky J, et. al. Haplotype diversity of stem rust resistance loci in uncharacterized wheat lines. Molecular Breeding. 2010;26(4):667–680. doi: 10.1007/s11032-010-9403-7 EDN: NYRAPP
  28. Jin Y, Szabo LJ, Rouse MN, Fetch TJr, Pretorius ZA, Wanyera R, et. al. Detection of virulence to resistance gene Sr36 within the TTKS race lineage of Puccinia graminis f. sp. Tritici. Plant Disease. 2009;93(4):367–370. doi: 10.1094/PDIS-93-4-0367.
  29. Kerber ER, Dyke PL. Transfer to hexaploid wheat of linked genes for adult-­plant leaf rust and seedling stem rust resistance from amphiploid of Aegiolops speltoides × Triticum monoccum. Genome. 1990;33(4):530–537.
  30. Klindworth DL, Niu Z, Chao S, Friesen TL, Faris JD, Cai X et al. Introgression and characterization of a goatgrass gene for a high level of resistance to Ug99 stem rust in tetraploid wheat. Genes, Genomes, Genetics. 2012;2(6):665–673. doi: 10.1534/g3.112.002386

Supplementary files

Supplementary Files
Action
1. JATS XML

Copyright (c) 2026 Petin V.A., Lepekhov S.B., Lapochkina I.F., Gainullin N.R.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.