Identification of drought-tolerant bread wheat Triticum aestivum L. genetic resources using molecular markers
- Authors: Walli M.H.1,2, Duksi F.1, Al-jubouri Z.2, Zargar M.1, Alhasnawi A.2
-
Affiliations:
- RUDN University
- Al-Muthanna University
- Issue: Vol 21, No 1 (2026)
- Pages: 41-54
- Section: Genetics and plant breeding
- URL: https://agrojournal.rudn.ru/agronomy/article/view/20307
- DOI: https://doi.org/10.22363/2312-797X-2026-21-1-41-54
- EDN: https://elibrary.ru/DZOGID
- ID: 20307
Cite item
Full Text
Abstract
To mitigate climate change and support the global agricultural economy, plant breeding and improvement programmes have received significant attention to obtain genetic resources rich in tolerant genes. In our study, twenty ISSR primers were used to evaluate genetic variation for 23 genotypes. SSR markers and the Sanger sequencing method were used to detect drought-tolerant genotypes and identify target gene loci. ISSR-PCR results showed a total of 820 DNA bands, of which 172 bands were polymorphic (117 non-unique bands and 55 unique bands) with a polymorphism percentage of 88.6. In the similarity matrix and dendrogram, genotypes were divided into clusters according to the genetic origins of the parents. These results demonstrated that ISSR markers are a valuable method for determining genetic variation, and identification of wheat genetic origins. Using primers SSR-PCR (Malek 1, Malek 2), genotypes (AB, NF, CL, UD, SA, TB) were detected as having drought tolerance genes. DNA sequencing by Sanger sequencing method of the genotypes, genes (DRF1, NAC20L) were identified in the wild parent (Triticum turgidum L), which is considered the source of the tolerant genes. Sample sequences and genotypes were recorded in the Gene Bank and The NCBI Bankit platforms. DNA sequencing technology has proven its effectiveness in confirming field results and identifying targeted genetic sites in the wheat genome.
Keywords
Full Text
Introduction
Global climate change is causing significant challenges for countries like Iraq, affecting over 70% of its irrigated areas [1]. The issue of rising temperatures, evaporation, and river desiccation, combined with dam construction and saline groundwater irrigation, poses a threat to food security [1, 2]. Wheat (Triticum aestivum) is among the most important food crops worldwide in production and use as food. The Food and Agriculture Organization (FAO) reports that wheat production averaged 765140714.8 tons from 2016 to 2016–2022, making it the third strategic crop globally after maize and sugarcane. The amount of wheat production in Asia reached 335,995,076.7 tonnes [1]. Iraq is one of the most important centres for wheat production and breeding, contributing more than 20% of the world’s food needs [3]. This cereal crop is the top choice among all cereal crops and is highly valued economically, making it a crucial strategic food crop. Wheat production in Iraq totalled roughly 3,683,604,429 tonnes, cultivated over an area of 1,334,193 hectares from 2016 to 2022. Increasing world population, coupled with abiotic stresses and global warming, has led to a decline in agricultural areas [4]. The Tigris and Euphrates rivers’ declining water supply has worsened drought and water salinity, necessitating vertical agricultural expansion, requiring plant breeders to develop tolerant varieties [5]. Inter Simple Sequence Repeat ISSR markers are crucial in identifying genetic variations in wheat plants [6]. ISSR markers reveal significant genetic variation in wheat germplasms, with high polymorphic loci percentages observed in 80.5% bread wheat and 98.2% durum wheat populations [7, 8]. DNA sequencing methodologies have advanced wheat breeding and enhancement studies by discovering genetic variation linked to specific traits [9]. Utilising modern biotechnological techniques, including DNA markers and gene sequencing, to identify genes in diverse crop species is a dependable approach for locating drought-tolerant genetic resources in contrast with physical and biological features that may be affected by environmental factors.
The objectives of this study were to perform molecular diagnosis of drought-tolerant wheat genotypes and to identify drought tolerance genes through genomic sequencing.
Materials and Methods
Materials: The study included 23 genotypes of bread wheat (Triticum aestivum L.), which are listed in Table 1. We collected 18 genotypes from the Gene Bank and accredited research centres affiliated with the Ministry of Agriculture and Higher Education in Iraq, while other genotypes are from the Russian Federation, France, Italy, Spain and Turkey.
Table 1
Genetic sources (genotypes) in the study, origin, sources
N | Genotype | Sample | Pedigree | Origin |
1 | Baraka | AB | IARI × STD | Iraq (hybridization) |
2 | Wafia | BW | Attila / 3* Pastor,(CIMMYT, ICARDA) | Imported from France |
3 | Latifiya | CL | Australian breed × Aras | Iraq (hybridization) |
4 | Binakal | DB | BISU/3/YAV79/ALOI/ALTARS4/CD93683.7Y.040M‑03 OY-LPAP.B | Imported from Spanish |
5 | Uruk | EU | Inia 66 (Rad) Irradiation of seeds of Enya 66 | Iraq (Irradiation) |
6 | Sham | FS | W‑3018-A/JUPATECO‑73 | Iraq (Irradiation) |
7 | Fateh | GF | MixPac × Aras | Iraq (hybridization) |
8 | Buhuth 10 | HB | Abaa 95 × Abaa 99 | Iraq (hybridization) |
9 | Buhuth 158 | IB | 119-S2/57-S2. Cr7.S2 | Iraq (Irradiation) |
10 | Babul 113 | JB | MEXIPAK/R23 | Iraq (Irradiation) |
11 | Al Iraq | KA | Irradiation of Mexipac seeds with full cobalt | Iraq (Irradiation) |
12 | Bwru | LB | H31/Trapf21 / Enesco | Italy |
13 | Baghdad | MB | MX105–6MVLT40 / BNSN | Iraq (hybridization) |
14 | Faris | NF | STAR/TR77/773/SLMS | Iraq (Irradiation) |
15 | Tammuz | OT | Exposing the resulting hybrid | Iraq (hybridization and irradiation) |
16 | Buhuth | PB | 118//S2/57-S2-CR7-S2 | Iraq (hybridization) |
17 | Abaa 95 | QA | Veery eer | CIMMYT |
18 | Abaa 99 | RA | Ures/Boww/oowwJup/ Biyiy | CIMMYT |
19 | Abo ghurayb | SA | Ajeeba × Lian 12 × Mexico24 | Iraq (hybridization) |
20 | Buhuth 22 | TB | CMSS96Y03236M‑050M‑040M‑020M‑050Sy‑ | Iraq (Irradiation) |
21 | Dujela | UD | 8409644HS2–6H | Iraq (Irradiation) |
22 | Nemchinovka | VN | (Donshchina × Pamyati Fedina) × Moskovskaya 39 | Imported from Russia |
23 | Abo Raghif | WA | Inia 66 / 2 × Mexipak | Imported from Turkey |
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.
DNA Extraction: Genomic DNA was isolated from 10‑day-old fresh leaves of 23 bread wheat genotypes utilising the Favorgen Plant DNA Maxi Kit (FAVORGEN BIOTECH CORP) in accordance with the manufacturer’s guidelines [10, 11]. DNA purity and concentration were verified using a NanoDrop spectrometer, and samples were diluted with TE solution to the required concentration.
PCR amplification utilising ISSR primers: In this study, 20 ISSR primers were used to detect genetic variation in wheat cultivars, based on the manufacturer Alpha DNA Canada in Table 2 [10, 12]. The PCR reaction (total volume of 25 µl) contained 2 µl of genomic DNA, 1 µl of ISSR primer, 12.5 µl of Master Mix, and 9.5 µl of nuclease-free water. PCR cycles started with an initial denaturation phase of 3 minutes at 94 °C, succeeded by 32 cycles comprising denaturation for 30 seconds at 94 °C, annealing for 30 seconds at 45–59 °C (as specified by the primers’ annealing temperature in Table 2), extension for 1 minute at 72 °C, and concluding with a final extension step of 5 minutes at 72 °C. PCR products were separated by electrophoresis on 1.5% agarose gels in 1×TBE buffer at 125 V for 30 minutes. A 100–1500 bp DNA ladder was used as a size marker. Gels were visualized under UV light (260 nm). For each accession, reproducible ISSR bands were scored by analysing gel images using Gel Analyzer 23.1.1 software to convert band patterns into digital data.
Table 2
Primer sequence (5’–3’), temperature, and length for twenty ISSR markers in this study [12–14]
N | Primers | Sequences 5’-3’ | Length (meres) | Annealing, °C |
1 | ISSR‑1 | (AG)9C | 19 | 58 |
2 | ISSR‑2 | (AC)8G | 17 | 52 |
3 | ISSR‑3 | (AG)8T | 17 | 50 |
4 | ISSR‑4 | (TG)8C | 17 | 52 |
5 | ISSR‑5 | (AC)8Y | 17 | 48 |
6 | ISSR‑6 | A(CAG)5 | 16 | 52 |
7 | ISSR‑7 | B(CT)8Y | 18 | 50 |
8 | ISSR‑8 | R(ACA)5 | 16 | 40 |
9 | ISSR‑9 | (CAC)7G | 22 | 74 |
10 | ISSR‑10 | (CT)9Y | 19 | 56 |
11 | ISSR‑11 | (CA)8DT | 18 | 50 |
12 | ISSR‑12 | (CTC)6G | 19 | 64 |
13 | ISSR‑13 | (GT)8C | 17 | 52 |
14 | ISSR‑14 | G(CA)8 | 17 | 52 |
15 | ISSR‑15 | (GAA)7 | 21 | 56 |
16 | ISSR‑16 | (GA)8V | 17 | 48 |
17 | ISSR‑17 | (GT)8C | 17 | 52 |
18 | ISSR‑18 | (GA)8G | 17 | 52 |
19 | ISSR‑19 | (GA)8HC | 18 | 52 |
20 | ISSR‑20 | (GACA)5 | 20 | 60 |
Note. B = C, G, T; D = A, G, T; H = A, C, T; R = A, G; V = A, C, G; Y = C, T.
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.
Detection of polymorphism of genotypes and primers: Numeric data signifies the presence of band 1 and the absence of band 0. Bands exhibiting identical mobility were assessed as equivalent. The Polymorphic Information Content (PIC) values for each primer were calculated by assessing the allele frequency at each locus according to [15, 16]which the marker possesses, and their relative rates. There are two indexes, or measures, usually used for the polymorphism degree evaluation. They are the heterozygosity (Н, using the formula
PIC = 2fi(1−fi),
where fi is the frequency of the amplified allele.
The Effective Multiplex Ratio (EMR) refers to the quantity of polymorphic fragments identified per assay. EMR and Marker Index (MI) for the marker system were computed to assess the efficacy of the marker system [17].
EMR = np/n,
where np represents the count of polymorphic loci, and n is the total number of loci.
MI = EMR × PIC. The Multiplex Ratio (MR) was calculated by dividing the total number of amplified bands by the total number of assays. The resolving power (Rp), indicating the capacity of the most informative primers to distinguish between genotypes, was evaluated according to [15, 16] using: Rp = ∑ Ib, where Ib represents band informativeness, defined as Ib = 1 — [2x(0.5 — p)], where p denotes the proportion of clones that possess the band. The resolving power depends on the distribution of identified bands among the sampled genotypes.
The coefficient of genetic similarity (GS) between genotypes was estimated by the Dice coefficient from binary data [17]. Dice formula
GSij = 2a/(2a + b + c),
where GSij is the measure of genetic similarity between individuals i and j, a is the number of bands shared by i and j, b is the number of bands present in i and absent in j, and c is the number of bands present in j and absent in i. The similarity matrix was employed to assess the cluster. The distance between each pair of groups was calculated as the average distance among all pairings inside the two related groups until all groups were interconnected. A dendrogram was used using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA) by the between-groups linkage method in SPSS to know the genetic relations between genotypes of wheat [16, 17].
PCR amplification by using SSR (microsatellite) markers: The purpose of the test: Enhancing the morphological results that appeared in the field; detecting genes that are tolerant to drought using molecular markers. Group A, with the genotypes AB, CL, NF, SA, TB and UD, was selected after analysing field experimental data and classifying genotypes according to tolerance to drought levels, with the addition of three of the genotypes, PB, JB and LB, from other groups to demonstrate the accuracy of SSR markers. Selection of the TaDREB3 gene in chromosomal locations of bread wheat that have shown their ability to contribute to tolerance to water stress [18], so primers were made; therefore, new primers (Malek 1, Malek 2) were selected in this study using the NCBI Primer-BLAST tool and Primer3 Plus software. These were used alongside previously known primers (Xgwm130 and Xwmc245) [19, 20] to detect drought-tolerant wheat genotypes.
Genomic DNA of wheat genotypes was subjected to SSR analysis using four primers (Table 3) as genetic markers associated with drought tolerance and approved in several sources in the selective breeding programme [19]. The primers were made by Alpha ADN, S.E.N.C., www.alphaadn.com. A total of 36 samples were analysed in the SSR test, with 9 samples per primer representing the genotypes included in the study. To prepare the template, there are several materials added according to the manufacturer of the Master Max PCR. Samples were numbered before DNA was added. The PCR reaction mixture of 25 μl comprised 12.5 μl of 10X Taq Master Mix with Standard Buffer, 2 μl of template DNA, 9.5 μl of nuclease-free water, 0.5 μl of 10 µM forward primer, and 0.5 μl of 10 µM reverse primer. The reaction mixtures were subjected to an initial heating at 94 °C for 3 minutes, followed by 32 cycles consisting of 94 °C for 30 seconds, 40–55 °C for 30 seconds (depending on the primer used), and 72 °C for 1 minute. A final extension was conducted at 72 °C for 5 minutes. SSR-PCR products were analysed via agarose gel electrophoresis, following these steps: a 3% agarose gel was prepared by dissolving 1.5 g of agarose in 100 ml of 1X TBE. Subsequently, 2 µL of ethidium bromide stain was incorporated into the agarose gel solution. A DNA marker ladder (100–1500 bp) supplied by TRANS-China was loaded into one well. An electric current was applied at 125 V for 25 minutes, followed by 75 V for 1 hour. SSR-PCR products were visualised using ultraviolet (UV) light at 365 nm with a photo imaging system.
Table 3
Names of SSR primers, sequence, length and sources
N | Primer | Primer Sequence | Length (k-mers) | Temperature, ˚C | Source |
1 | Malek 1 | F GGTAGATCGGAAGGACGCTGR CAGGGGGCTCATCACCAAAT | 2020 | 6462 | NEW |
2 | Malek 2 | F ATTGCAAGGAGCACATCCGAR TCAGCATCATGGAAGGCAGG | 2020 | 6062 | NEW |
3 | Xgwm130 | F AGCTCTGCTTCACGAGGAAGR CTCCTCTTTATATCGCGTCCC | 2021 | 6264 | [20] |
4 | Xwmc245 | F GCTCAGATCATCCACCAACTTCR AGATGCTCTGGGAGAGTCCTTA | 2222 | 6666 | [21] |
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.
Sequencing Methods: DNA samples of the five genotypes (AB, NF, UD, SA, TB) that showed tolerance to drought in SSR-PCR tests were sent to Alpha ADN Canadian, www.alphaadn.com, by comparing local samples’ nucleic acid sequences with retrieved sequences, using Sanger dideoxy sequencing technology. Madison’s BioEdit Sequence Alignment Editor Software Version 7.1 was used to analyse the PCR product of a targeted sample. The software was used to compare observed nucleic acid sequences with retrieved sequences, identifying virtual positions and details of PCR fragments. The sequences were numbered in PCR amplicons and corresponding positions within the referring genome, ensuring accurate analysis of the sample. PCR amplicons were used to identify variations in sequenced samples, which were then translated to their corresponding amino acid sequences to assess the impact of these variations on the encoded protein, using the Expasy translate suite. The NCBI Bankit portal was used to submit investigated sequences, which were then analysed and provided as nucleic acid sequences to GenBank for unique accession numbers.
Results and Discussion
Molecular characterisation of wheat genotypes by ISSR-PCR markers. In the PCR-ISSR investigation of the genotypes presented in Table 4, twenty ISSR primers were utilised to amplify a total of 820 fragments, yielding an average of 41 bands per primer MR. The electrophoresis of primers ISSR‑8 and ISSR‑20 did not demonstrate the existence of fragments, suggesting the absence of bands. In these pieces, 37.6 bands were identified as polymorphic. The number of polymorphic bands produced by ISSR primers ranged from 18 (ISSR‑7, ISSR‑6) to 71 (ISSR‑3, ISSR‑18). The percentage of polymorphism between genotypes and lines varied from 37% (ISSR‑15) to 100% (ISSR‑3, ISSR‑13, ISSR‑18), yielding an average polymorphism of 68% per primer. Mb comprises 69 bands in ISSR‑1, ISSR‑15, and ISSR‑19. The number of unique bands (Ub) was 55 bands with an average of 2.8 per primer. Primer ISSR‑15 detected the highest number of unique bands (7 bands). The highest Marker Index (MI) value was observed for the ISSR‑1 primer (11.34) with an average of 5. The highest percentage of Resolving Power (RP) was found for the ISSR‑3 and ISSR‑18 primers (9.45). Regarding Polymorphic Information Content (PIC), the highest value was recorded for the ISSR‑11 primer (0.29) with an average of 0.2. The average molecular weight (MW) of the primers ranged from 184.45 to 2042.3, with the highest MW observed for the ISSR‑1 primer (3388). The results of PCR-ISSR analysis showed that most of the primers showed the ability to distinguish between the genotypes in the experiment; the largest number of bands for the KA genotype was 45, with an average of 2.25 for all primers. As for the least number of bands that appeared in the WA genotype, it reached 23 bands, and the average was 2.25.
Table 4
Distinct characteristics of ISSR primers included in the study: primer names, a Total of bands (Tb), Polymorphic bands (Pb), polymorphism (P%), Monomorphic bands (Mb), number of Unique bands (Ub), Non-Unique bands (Non-Ub), Marker Index (MI), Resolving Power (RP), Polymorphic Information Content (PIC), Molecular Weight (MW)
Primers | Mb | Ub | Non-Ub | Pb | Tb | P% | EMR | PIC | RP | MI | MW(bp) |
ISSR‑1 | 1 | 2 | 5 | 7 | 8 | 87.5 | 612.5 | 0.15 | 1.39 | 92.0 | 25–3388 |
ISSR‑2 | 0 | 3 | 4 | 7 | 7 | 100 | 700 | 0.23 | 1.91 | 158.8 | 424–1315 |
ISSR‑3 | 0 | 5 | 8 | 13 | 13 | 100 | 1300 | 0.20 | 3.30 | 253.9 | 302–2877 |
ISSR‑4 | 0 | 2 | 5 | 7 | 7 | 100 | 700 | 0.23 | 2.09 | 158.8 | 145–2457 |
ISSR‑5 | 0 | 4 | 7 | 11 | 11 | 100 | 1100 | 0.23 | 3.74 | 257.8 | 77–3004 |
ISSR‑6 | 0 | 1 | 5 | 6 | 6 | 100 | 600 | 0.22 | 1.65 | 132.3 | 153–1603 |
ISSR‑7 | 0 | 2 | 2 | 4 | 4 | 100 | 400 | 0.27 | 1.57 | 106.6 | 75–1814 |
ISSR‑8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
ISSR‑9 | 0 | 3 | 4 | 7 | 7 | 100 | 700 | 0.21 | 2.96 | 148.7 | 700–2729 |
ISSR‑10 | 0 | 2 | 7 | 9 | 9 | 100 | 900 | 0.25 | 2.78 | 222.3 | 605–2872 |
ISSR‑11 | 0 | 5 | 9 | 14 | 14 | 100 | 1400 | 0.29 | 1.74 | 410.2 | 268–1622 |
ISSR‑12 | 0 | 2 | 2 | 4 | 4 | 100 | 400 | 0.19 | 0.87 | 74.1 | 78–313 |
ISSR‑13 | 0 | 3 | 8 | 11 | 11 | 100 | 1100 | 0.21 | 2.96 | 235.2 | 2–1740 |
ISSR‑14 | 0 | 4 | 11 | 15 | 15 | 100 | 1500 | 0.21 | 4.17 | 319.8 | 187–3091 |
ISSR‑15 | 1 | 7 | 6 | 13 | 14 | 92.9 | 1207.1 | 0.15 | 2.52 | 181.9 | 52–2105 |
ISSR‑16 | 0 | 2 | 4 | 6 | 6 | 100 | 600 | 0.24 | 1.91 | 142.9 | 88–2473 |
ISSR‑17 | 0 | 2 | 13 | 15 | 15 | 100 | 1500 | 0.21 | 2.43 | 315.3 | 13–2898 |
ISSR‑18 | 0 | 4 | 9 | 13 | 13 | 100 | 1300 | 0.25 | 4.70 | 330.4 | 74–1996 |
ISSR‑19 | 1 | 2 | 8 | 10 | 11 | 90.9 | 909.1 | 0.18 | 2.43 | 166.9 | 189–2549 |
ISSR‑20 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
SUM | 3 | 55 | 117 | 172 | 175 | 1771.3 | 16928.7 | 3.9 | 45.1 | 3708.1 | 3689–40846 |
MEAN | 0.15 | 2.75 | 5.85 | 8.6 | 8.75 | 88.6 | 846.4 | 0.2 | 2.3 | 185.4 | 184.45–2042.3 |
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.
Dendrogram analysis for 23 genotypes based on ISSR-PCR data. Genetic similarity among the 23 genotypes was estimated from the matrix data (Table 5). The Genetic Similarity (GS) values derived from ISSR data ranged from 0.21 (WA vs. CL) to 0.75 (MB vs. RA). The average GS value across all genotypes was 0.48 for the ISSR marker. This indicates that the average distance between genetic structures is 0.52.
Dendrogram in Figure 1 shows the presence of two main groups. The first group (14) included the WA genotype with genetic origins from Turkey. It can be noted that the genetic origins of this variety are far from the genetic groups by up to 0.79. The second group was divided into subgroups. Group 3 included the BW variety with genetic origins from France, and the genetic distance from groups 1 and 2 within the group was about 0.63. Group 1 genotype AB is unique in genetic origins and morphological characteristics from the other groups and is considered the closest to group 2 for genotypes DB and EU. In group 8 most of the genotypes were similar in terms of the genetic origins of the parents in Table 1. The similarity between the group 8 and group 9 genotype VN imported from the Russian Federation is 0.57. The genotypes RA and QA that go back to the same genetic sources (CIMMYT) were linked, as well as RA, which is considered one of the parents in the hybridisation of the variety HB, while the closest similarity between the genotypes MB and RA was 0.75. Group 10 includes the genotypes JB and OT resulting from mutation by radiation descending from the genetic origin of one of the parents (MEXIPAK) in Table 1.
Table 5
Genetic similarity matrix (Dice similarity coefficient) among 23 wheat genotypes for Molecular characterization
| AB | BW | CL | DB | EU | FS | GF | HB | IB | JB | KA | LB | MB | NF | OT | PB | QA | RA | SA | TB | UD | VN | WA |
AB | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
BW | 0.37 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
CL | 0.32 | 0.4 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
DB | 0.47 | 0.40 | 0.41 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
EU | 0.47 | 0.42 | 0.40 | 0.52 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
FS | 0.30 | 0.40 | 0.41 | 0.35 | 0.4 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
GF | 0.26 | 0.44 | 0.51 | 0.44 | 0.49 | 0.47 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
HB | 0.35 | 0.29 | 0.47 | 0.46 | 0.38 | 0.55 | 0.51 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
IB | 0.31 | 0.26 | 0.51 | 0.39 | 0.33 | 0.44 | 0.54 | 0.62 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
JB | 0.29 | 0.27 | 0.41 | 0.46 | 0.48 | 0.54 | 0.45 | 0.57 | 0.53 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
KA | 0.33 | 0.30 | 0.41 | 0.45 | 0.49 | 0.38 | 0.49 | 0.46 | 0.39 | 0.45 | 1 |
|
|
|
|
|
|
|
|
|
|
|
|
LB | 0.30 | 0.26 | 0.41 | 0.36 | 0.30 | 0.58 | 0.39 | 0.56 | 0.51 | 0.47 | 0.36 | 1 |
|
|
|
|
|
|
|
|
|
|
|
MB | 0.37 | 0.33 | 0.46 | 0.40 | 0.42 | 0.51 | 0.53 | 0.67 | 0.65 | 0.51 | 0.48 | 0.55 | 1 |
|
|
|
|
|
|
|
|
|
|
NF | 0.32 | 0.36 | 0.46 | 0.45 | 0.45 | 0.54 | 0.59 | 0.64 | 0.50 | 0.57 | 0.55 | 0.49 | 0.58 | 1 |
|
|
|
|
|
|
|
|
|
OT | 0.35 | 0.39 | 0.37 | 0.54 | 0.56 | 0.50 | 0.59 | 0.58 | 0.54 | 0.62 | 0.53 | 0.43 | 0.55 | 0.61 | 1 |
|
|
|
|
|
|
|
|
PB | 0.26 | 0.24 | 0.30 | 0.29 | 0.26 | 0.39 | 0.38 | 0.46 | 0.43 | 0.43 | 0.32 | 0.51 | 0.54 | 0.42 | 0.44 | 1 |
|
|
|
|
|
|
|
QA | 0.31 | 0.29 | 0.43 | 0.39 | 0.44 | 0.55 | 0.47 | 0.62 | 0.56 | 0.54 | 0.47 | 0.46 | 0.65 | 0.65 | 0.53 | 0.57 | 1 |
|
|
|
|
|
|
RA | 0.28 | 0.36 | 0.43 | 0.40 | 0.48 | 0.46 | 0.54 | 0.66 | 0.60 | 0.58 | 0.51 | 0.44 | 0.75 | 0.62 | 0.68 | 0.45 | 0.67 | 1 |
|
|
|
|
|
SA | 0.41 | 0.41 | 0.45 | 0.47 | 0.46 | 0.56 | 0.51 | 0.56 | 0.43 | 0.50 | 0.49 | 0.42 | 0.53 | 0.62 | 0.56 | 0.41 | 0.59 | 0.57 | 1 |
|
|
|
|
TB | 0.40 | 0.45 | 0.40 | 0.42 | 0.49 | 0.48 | 0.62 | 0.51 | 0.44 | 0.50 | 0.58 | 0.41 | 0.53 | 0.58 | 0.58 | 0.42 | 0.53 | 0.56 | 0.59 | 1 |
|
|
|
UD | 0.26 | 0.35 | 0.38 | 0.39 | 0.40 | 0.56 | 0.53 | 0.55 | 0.47 | 0.56 | 0.50 | 0.39 | 0.51 | 0.57 | 0.62 | 0.40 | 0.60 | 0.52 | 0.50 | 0.67 | 1 |
|
|
VN | 0.27 | 0.25 | 0.42 | 0.37 | 0.34 | 0.55 | 0.41 | 0.64 | 0.57 | 0.53 | 0.44 | 0.45 | 0.58 | 0.56 | 0.54 | 0.49 | 0.56 | 0.57 | 0.57 | 0.49 | 0.55 | 1 |
|
WA | 0.26 | 0.28 | 0.21 | 0.27 | 0.32 | 0.32 | 0.23 | 0.39 | 0.37 | 0.36 | 0.33 | 0.30 | 0.38 | 0.45 | 0.41 | 0.34 | 0.44 | 0.42 | 0.43 | 0.38 | 0.39 | 0.47 | 1 |
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.
Molecular diagnosis of drought-tolerant genotypes by SSR markers. The PCR-SSR marker analysis was conducted. Gel electrophoresis of the amplified products revealed bands indicating drought tolerance in the tested genotypes. For primer Malek 1, gel electrophoresis revealed the presence of radioactive bands corresponding to the genotypes CL, NF, SA, UD, and TB (Figure 2). For primer Malek 2, bands were observed for genotypes TB, UD, SA, and NF (Figure 2). These radioactive bands indicate the interaction of the primers with the DNA genome of the candidate samples. As for the genotypes (PB, JB, LB), they did not appear in either primer, which confirms the validity of the morphological and physiological results in the field. Primers Xgwm130 and Xwmc245 did not show any binding or interaction with the samples due to the genetic differences between the wheat varieties. This finding aligns with the research objective of identifying new strains tolerant to environmental conditions, which could facilitate wheat breeding and improvement programs aimed at developing new genetic patterns with high productivity under harsh environmental conditions. Based on these results, the genotypes NF, UD, SA, TB, AB and CL were selected for subsequent sequencing and genetic mapping studies.
Fig. 1. The dendrogram generated by using UPGMA cluster analysis according to the Dice similarity coefficient obtained from ISSR primers for the twenty-three bread wheat genotypes
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.
Fig. 2. Gel electrophoresis analysis of primers (Malek 1, Malek 2)
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.
Sequencing Results. The sequencing reactions indicated the exact identity after performing NCBI BLASTn for these PCR amplicons. Concerning the DRF1 gene, the NCBI BLASTn engine showed up to 99% sequence similarity between the sequenced samples (assigned E1, E2, R1, R2, and R3) and the intended DRF1 gene sequences of Triticum turgidum (GenBank acc. KM504244.1). As well, the NCBI BLASTn engine showed 100% sequence similarity between the sequenced samples (assigned S1, S2, S3, S4, S5) and the NAC20L gene sequences of Triticum aestivum (GenBank acc. XM_044571539.1). The genotype T. turgidum durum is one of the parents of bread wheat and durum wheat; it is a tetraploid wheat (2n = 4x = 28, AABB) [22]. The geographical distribution of wild wheat is in the Fertile Crescent region in southwest Asia, Palestine, Jordan, Lebanon, Syria, southern Turkey, northern Iraq, and southwest Iran [23, 24]. It can serve as one of the most important genetic resources to improve durum (Triticum turgidum L. ssp. durum (Desf.) and bread wheat (Triticum aestivum L.), and it has been used for allele mining to address various wheat breeding requirements, including, but not limited to, drought [25, 26] and salinity tolerance [27], as well as resistance to biotic stress factors. All the investigated genetic sequences were deposited in the NCBI web server, and unique accession numbers were obtained for all analysed sequences in Table 6.
Table 6
GenBank accession numbers for nucleotide sequences https://www.ncbi.nlm.nih.gov/genbank/
Locus | Accession. № | GenBank. № | Amplicon | Source | Primers | Strain | Samples | Genotypes |
Seq1 | PP873665 | BankIt 2835921 | DRF1 | T. turgidum | Malek 1 | Malek-E1 | E1 | AB |
Seq2 | PP873666 | Malek-E2 | E2 | CL | ||||
Seq3 | PP873667 | Malek-R1 | R1 | NF | ||||
Seq4 | PP873668 | Malek-R2 | R2 | SA | ||||
Seq5 | PP873669 | Malek-R3 | R3 | TB | ||||
Seq6 | PP873670 | NAC20L | T. aestivum | Malek 2 | Malek-S1 | S1 | CL | |
Seq7 | PP873671 | Malek-S2 | S2 | NF | ||||
Seq8 | PP873672 | Malek-S3 | S3 | SA | ||||
Seq9 | PP873673 | Malek-S4 | S4 | TB | ||||
Seq10 | PP873674 | Malek-S5 | S5 | UD |
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.
Conclusion
Genotypes AB, NF, CL, UD, SA, and TB were tolerant to drought stress. The wild resource (Triticum turgidum L.) can be considered a source of drought tolerance genes and be relied upon in breeding and genetic engineering programs. The genes DRF1 and NAC20L are responsible for wheat drought tolerance, and the primers Malek 1 and Malek 2 can be considered ideal for detecting these genes. DNA markers, such as ISSR-PCR markers, are a powerful tool for identifying the genetic diversity of wheat varieties. The 20 primers used were able to identify the genetic fingerprint of the twenty-three genotypes of wheat.
1 FAO. Food and Agriculture Organization of the United Nations. FAOSTAT. 2022. https://www.fao.org/faostat/en/#data/HS
About the authors
Malek H. Walli
RUDN University; Al-Muthanna University
Author for correspondence.
Email: malek_h88@yahoo.com
ORCID iD: 0000-0002-4884-6481
Ph.D Student of Department of Agrobiotechnology, Agrarian and Technological Institute, RUDN University; Department of Biology, College of Nursing, Al-Muthanna University
6 Miklukho-Maklaya st., Moscow, 117198, Russian Federation; Samawah, 66001, IraqFatima Duksi
RUDN University
Email: f.duksi@gmail.com
ORCID iD: 0000-0002-7353-7816
SPIN-code: 9937-6393
Ph.D Student of Department of Agrobiotechnology, Agrarian and Technological Institute
6 Miklukho-Maklaya st., Moscow, 117198, Russian FederationZina Al-jubouri
Al-Muthanna University
Email: Zinah480@gmail.com
ORCID iD: 0009-0005-6908-5385
lecturer Department of Statistics, Faculty of Pharmacy
Samawah, 66001, IraqMeisam Zargar
RUDN University
Email: zargar-m@rudn.ru
ORCID iD: 0000-0002-5208-0861
PhD in Agricultural sciences, professor, Department of Agrobiotechnology, Agrarian and Technological Institute
6 Miklukho-Maklaya st., Moscow, 117198, Russian FederationArshad Alhasnawi
Al-Muthanna University
Email: arshad@mu.edu.iq
ORCID iD: 0000-0003-2817-8807
Ph.D., Department of Biology, College of education for pure Sciences
Samawah, 66001, IraqReferences
- Qureshi AS, Al-Falahi AA. Extent, Characterization and causes of soil salinity in Central and Southern Iraq and possible reclamation strategies. International Journal of Engineering Reseach and Applications. 2015;5(1).
- Al-Jassim KAH. Natural reasons causing soil salinity and its impact of plant production in Ali-Algharbi district. Iraqi Journal of Desert Studies. 2021;11(2):164–186. doi: 10.36531/desert.2022.172743 EDN: DODRDX
- Braun HJ, Atlin G, Payne T. Multi-location testing as a tool to identify plant response to global climate change. In: Climate change and crop production. Wallingford, UK: CABI; 2010. p.115–138. doi: 10.1079/9781845936334.0115
- Walli MH, AL-Jubouri Z, Madumarov MM, Margaryta M, Aldibe AAA. Genetic and environment diversity to improve wheat (Triticum spp.) productivity: a review. Research on Crops. 2022;23(2):295–306. doi: 10.31830/2348-7542.2022.041 EDN: ATEWCG
- Jha S. Transgenic approaches for enhancement of salinity stress tolerance in plants. In: Singh SP, Upadhyay SK, Pandey A, Kumar S. (eds.) Molecular Approaches in Plant Biology and Environmental Challenges. Singapore: Springer; 2019. p. 265–322. doi: 10.1007/978-981-15-0690-1_14 EDN: DWRDUX
- Jabari M, Golparvar A, Sorkhilalehloo B, Shams M. Investigation of genetic diversity of Iranian wild relatives of bread wheat using ISSR and SSR markers. Journal of Genetic Engineering and Biotechnology. 2023;21(1):73. doi: 10.1186/s43141-023-00526-5 EDN: JZLXAK
- Aslanparviz M, Rashidi V, Omidi M, Etminan A, Ahmadzadeh A. Evaluation of population structure and estimation of genetic parameters in breeding lines and landraces populations of durum wheat using ISSR markers. Plant Genetic Researches. 2022;8(2):23–32. doi: 10.52547/pgr.8.2.2 EDN: IGJEZI
- Atsbeha G, Tesfaye K, Mekonnen T, Haileselassie T, Kebede M. Genetic diversity and population structure analysis of bread wheat (Triticum aestivum L.) germplasms as revealed by ISSR markers. Genetic Resources and Crop Evolution. 2024;71(6):2721–2735. doi: 10.1007/s10722-023-01791-6
- Shaheenuzzamn M, Liu T, Shi Sh, An P, Wu H, Wang Zh. Development of sequencing technology and role of next generation sequencing technologies in wheat research: a review. Pakistan Journal of Botany. 2020;52(5):1867–1878. doi: 10.30848/PJB2020-5(33) EDN: FGGOAR
- Dellaporta SL, Wood J, Hicks JB. A plant DNA minipreparation: Version II. Plant Molecular Biology Reporter. 1983;1(4):19–21. doi: 10.1007/BF02712670 EDN: RKVWRQ
- Porebski S, Bailey LG, Baum BR. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter. 1997;15(1):8–15. doi: 10.1007/BF02772108 EDN: XSNALF
- Mandal AM, Alhasnawi A, Jasim H, Mohamad A. Evaluation of salt stress and molecular analysis of genetic variation of Iraqi rice cultivars. Biodiversitas. 2019;20(11):3309–3314. doi: 10.13057/biodiv/d201125 EDN: VIEVRB
- Mohamad A, Alhasnawi AN, Kadhimi AA, Isahak A, Wan Yusoff WM, Che Radziah CMZ. DNA Isolation and Optimization of ISSR-PCR Reaction System in Oryza sativa L. International Journal on Advanced Science, Engineering and Information Technology. 2017;7(6):2264. doi: 10.18517/ijaseit.7.6.1621
- Alhasnawi AN. β-glucan-mediated alleviation of NaCl stress in Ocimum basilicum L. in relation to the response of antioxidant enzymes and assessment DNA marker. Journal of Ecological Engineering. 2019;20(8):90–99.
- doi: 10.12911/22998993/110790
- Chesnokov YuV, Artemyeva AM. Evaluation of the measure of polymorphism information of genetic diversity. Agricultural Biology. 2015;50(5):571–578. doi: 10.15389/agrobiology.2015.5.571eng EDN: UXSRIX
- Tonk FA, Tosun M, Ilker E, Istipliler D, Tatar O. Evaluation and comparison of ISSR and RAPD Markers for assessment of genetic diversity in triticale genotypes. Bulgarian Journal of Agricultural Science. 2014;20(6):1413–1420.
- Sneath PHA, Sokal RR. Numerical Taxonomy: The Principles and Practice of Numerical Classification. W.H. Freeman; 1973.
- Niu X, Luo T, Zhao H, Su Y, Ji W, Li H. Identification of wheat DREB genes and functional characterization of TaDREB3 in response to abiotic stresses. Gene. 2020;740:144514. doi: 10.1016/j.gene.2020.144514 EDN: YFERCV
- Haque MS, Saha NR, Islam MT, Islam MM, Kwon SJ, Roy SK, WOO SH. Screening for drought tolerance in wheat genotypes by morphological and SSR markers. Journal of Crop Science and Biotechnology. 2021;24(1):27–39. doi: 10.1007/s12892-020-00036-7 EDN: YNFVMQ
- Thungo Z, Shimelis H, Odindo A, Mashilo J, Shayanowako A. Genetic relationship among selected heat and drought tolerant bread wheat genotypes using SSR markers, agronomic traits and grain protein content. Acta Agriculturae Scandinavica, Section B — Soil & Plant Science. 2020;70(7):594–604. doi: 10.1080/09064710.2020.1818818 EDN: ERXVWZ
- Vaja KN, Gajera HP, Katakpara ZA, Patel SV, Golakiya BA. Microsatellite markers based genetic diversity analysis for salt tolerance in wheat genotypes. Indian Journal of Agricultural Biochemistry. 2016;29(2):140–145. doi: 10.5958/0974-4479.2016.00023.X
- Peng J, Sun D, Nevo E. Wild emmer wheat, ‘Triticum dicoccoides’, occupies a pivotal position in wheat domestication process. Australian Journal of Crop Science. 2011;5(9):1127–1143.
- Breseghello F, Sorrells ME. Association mapping of kernel size and milling quality in wheat (Triticum aestivum L.) cultivars. Genetics. 2006;172(2):1165–1177. doi: 10.1534/genetics.105.044586
- Balter M. Seeking agriculture’s ancient roots. Science. 2007;316(5833):1830–1835. doi: 10.1126/science.316.5833.1830
- Börner A, Korzun V, Worland AJ. Comparative genetic mapping of loci affecting plant height and development in cereals. Euphytica. 1998;100(1–3):245–248. doi: 10.1023/A:1018364425150 EDN: XOCJID
- Bolot S, Abrouk M, Masood-Quraishi U, Stein N, Messing J, Feuillet C, Salce J. The ‘inner circle’ of the cereal genomes. Current Opinion in Plant Biology. 2009;12(2):119–125. doi: 10.1016/j.pbi.2008.10.011
- Buckler ES, Thornsberry JM, Kresovich S. Molecular diversity, structure and domestication of grasses. Genetics Research. 2001;77(3):213–218. doi: 10.1017/S0016672301005158 EDN: FOCLGL
Supplementary files
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.
Source: compiled by M.H. Walli, F. Duksi, Z. Al-jubouri, M. Zargar, A. Alhasnawi.












